human plasmin powdered Search Results


95
ATCC own 10x genomic chromium dataset
scRNA-seq gene body coverage skewness and skewness distribution Three scRNA-seq datasets. (A) Distribution of mapped reads (tags) across genes. Each panel shows the gene body coverage percentile per dataset. The x axis represents the gene body from 5′ end to 3′ end scaled from 0 to 100, and the y axis denotes gene coverage (0–1). lThe plot of the dataset (ArrayExpress: E-MTAB-2600 ) generated by SMARTer protocol (full-length sequence) contains cells with low coverage in the middle of the gene region and cells with high coverage in the 3′ -end of the gene region. Although the dataset (NCBI GEO: GSE29087 ) generated by STRT (5′ -end sequence) contains cells with high coverage both in the middle and the 3′ -end region of the gene. The third dataset from <t>10x</t> Genomics generated by single-cell 3′ -end protocol contains cells with high coverage in the 5′ -end region of the gene and cells with low coverage in the middle of the gene. (B) Mean of the gene body coverage for different scRNA-seq methods. Error bars represents the standard error of the mean (SEM). (C) Skewness and bias in gene body coverage for cells highlighted with a red dashed box.
Own 10x Genomic Chromium Dataset, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/own 10x genomic chromium dataset/product/ATCC
Average 95 stars, based on 1 article reviews
own 10x genomic chromium dataset - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
Alomone Labs antibodies against nav1 7
Effect of GM-CSF on the current amplitude and expression level of <t>Nav1.7,</t> Nav1.8, and Nav1.9 channels. A, Relative mRNA expression of Nav1.7, Nav1.8, Nav1.9, Kv4.2, TMEM16A, P2X3, KCNQ2, and KCNQ3 in cultured DRG cells after incubation of GM-CSF (200 ng/ml) at 24 h (n = 9, unpaired t test, *p < 0.05 compared with the control). B, Relative mRNA expression of Nav1.7, Nav1.8, and Nav1.9 in DRG neurons of bone cancer pain at the seventh day. (n = 6, unpaired t test, *p < 0.05 compared with the control). C, Typical current traces and current density–voltage relationship of total TTX-S, TTX-R, Nav1.8, and Nav1.9 Na+ currents in cultured DRG cells after incubation with GM-CSF (200 ng/ml) for 24 h. D, Western blot analysis of expression levels of Nav1.7, Nav1.8, and Nav1.9 proteins in DRG neurons treated with GM-CSF (200 ng/ml) for 18 h (n = 3, unpaired t test, *p < 0.05 compared with the control).
Antibodies Against Nav1 7, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies against nav1 7/product/Alomone Labs
Average 93 stars, based on 1 article reviews
antibodies against nav1 7 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

92
Alomone Labs acc 060 f
KEY RESOURCES TABLE
Acc 060 F, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/acc 060 f/product/Alomone Labs
Average 92 stars, based on 1 article reviews
acc 060 f - by Bioz Stars, 2026-03
92/100 stars
  Buy from Supplier

94
Alomone Labs alomone s apc
Cross-reactivity Kir6.2-Kir6.1. (A) Staining of Kir6.1 (green; APC-105; Alomone Labs) and Kir6.2 (red; <t>APC-020;</t> Alomone Labs) in the same section of mouse brain tissue. Kir6.1 shows labeling in blood vessel-like structures and Kir6.2 in neuronal-like structures. This shows that the Kir6.2 antibody does not cross-react with the Kir6.1 epitope. (B) Western blot analysis of a lysate of HEK293T-cells transfected with an empty vector (lane 1) and HEK293T cells that overexpress Kir6.1 (NBL1-12174; Novus Biological, Littleton, CO) (lane 2). The membrane shown on the left was incubated with an anti-Kir6.1 antibody and the one on the right with an anti-Kir6.2 antibody. Only the Kir6.1 antibody was detecting the HEK293T-cells lysate showing that cross-reactivity does not occur between the Kir6.2 antibody and the Kir6.1 epitope.
Alomone S Apc, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/alomone s apc/product/Alomone Labs
Average 94 stars, based on 1 article reviews
alomone s apc - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

93
Alomone Labs hek293 cells
<t>TRPM7/TRPM6</t> protein expression and TRPM7 kinase activity in splenic T cells. ( A ) Western blot analysis of immunoprecipitated TRPM7 from whole cell lysates of WT and KD splenic T cells. T cells were stimulated with PMA/ionomycin or anti-CD3/CD28 antibody coated beads for 48 hrs. Mouse embryonic fibroblasts were used as a positive control. Equal amounts of protein before immunoprecipitation were ensured by probing for actin. ( B ) Incorporation of 32 P into exogenous myelin basic protein (MBP) by TRPM7 immunoprecipitated from WT and KD resting T cells. Equal quantities of MBP were verified by coomassie blue staining. ( C ) Control experiment showing that anti-TRPM6 antibody was able to recognize TRPM6, by immunoprecipitation using anti-TRPM6 antibody in GFP-TRPM6 transfected <t>HEK</t> cells ( D ). Western blot analysis of TRPM6 immunoprecipitated from WT and KD mouse T cells and kidneys. Full gel images are provided in Supplementary Fig. .
Hek293 Cells, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hek293 cells/product/Alomone Labs
Average 93 stars, based on 1 article reviews
hek293 cells - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Alomone Labs rat hcn1 amino terminus
Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for <t>HCN1-specific</t> (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.
Rat Hcn1 Amino Terminus, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat hcn1 amino terminus/product/Alomone Labs
Average 94 stars, based on 1 article reviews
rat hcn1 amino terminus - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

90
Nippon Soda Co Ltd hydroxypropyl cellulose (dry powder, hpc grade ssl-sfp)
Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for <t>HCN1-specific</t> (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.
Hydroxypropyl Cellulose (Dry Powder, Hpc Grade Ssl Sfp), supplied by Nippon Soda Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hydroxypropyl cellulose (dry powder, hpc grade ssl-sfp)/product/Nippon Soda Co Ltd
Average 90 stars, based on 1 article reviews
hydroxypropyl cellulose (dry powder, hpc grade ssl-sfp) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

96
Alomone Labs ab 2083496 nav1 6 node
Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for <t>HCN1-specific</t> (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.
Ab 2083496 Nav1 6 Node, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ab 2083496 nav1 6 node/product/Alomone Labs
Average 96 stars, based on 1 article reviews
ab 2083496 nav1 6 node - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Alomone Labs rabbit anti slc1a5
a, Schematic representation of the AAV8 expression vector for in vivo targeting of SC. U6, Pol III promoter driving the expression of the gRNA targeting the <t>Slc1a5</t> locus or a non-targeting control gRNA. Since the mice used in this experiment are LSL-Cas9 x PAX7:Cre-ERT mice, Cas9 is exclusively activated in Pax7 + cells upon tamoxifen administration and, genome editing of the Slc1a5 locus will occur selectively in SC. b, Schematic overview of an AAV8-based CRISPR/Cas9-mediated in vivo genome editing. c-d, Representative images ( c ) and quantification ( d ) for Pax7 and Cas9 staining on uninjured muscles before and after tamoxifen administration ( n =4). e-f , RT-qPCR for Slc1a5 in freshly isolated SC ( n =4) ( e ) and all other mononuclear cells (non-SC) ( n =3) ( f ) upon in vivo genome editing of the Slc1a5 locus (SLC1A5-KD) specific in SC. Non-targeting control gRNA (Ctrl gRNA) was used as a control. g-h, Quantification ( g ) and representative images ( h ) of SLC1A5 and Pax7 stainings on freshly isolated SC, upon in vivo genome editing of the Slc1a5 locus (SLC1A5-KD) specific in SC ( n =3). All experiments show representative values of at least 2 independent experiments. Unpaired two-tailed t -test was everywhere applied; ns, not significant ( P >0.05). Scale bars: 50 μm ( c ); 20 μm ( h ). Graphs show mean ± SEM.
Rabbit Anti Slc1a5, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti slc1a5/product/Alomone Labs
Average 90 stars, based on 1 article reviews
rabbit anti slc1a5 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Alomone Labs α chrnb4 antibody
(A–H) Immunohistochemistry of MafA WT and Maf A RIP islets to show expression of CHRNA4 (A and B; green), CHRNA5 (C and D; green), CHRNB2 (E and F; green), and <t>CHRNB4</t> (G and H; green). β cells are stained for insulin (red) and nuclei (DAPI; blue); scale bar represents 20 µm. (I) qPCR amplification of Chrn upstream sequences after immunoprecipitation of βTC-6 chromatin with a MAFA or rabbit IgG antibody are presented as % input. Differences in percent input for IgG reflect variations in primer efficiencies. n = 4. (J) Induction of luciferase reporter activity of ChrnB2 (pB2LUC) and ChrnB4 (pB4LUC) luciferase reporter constructs upon co-transfection with MAFA. Empty vector control (pGl2b and pFOX) is set to one; n = 3 or 4. (K) qPCR measurements of Chrn expression levels in MafA siRNA-treated βTC6 cells; n ≥ 3. Data were normalized to the geomean of HPRT and β- actin mRNA levels. (L) Dynamic insulin secretion of MafA WT and MafA RIP islets stimulated with 10 mM glucose (G) and 100 µM nicotine (NIC), 100 µM nicotine + 100 µM oxotremorine (NIC+OXO), and 100 µM oxotremorine (OXO). The transient decrease in insulin secretion upon NIC treatment in MafA WT islets is marked by a solid arrow. The biphasic insulin secretion induced by NIC+OXO treatment is indicated by a dashed arrow and a dotted arrow; n = 8. (M) Dynamic insulin secretion of wild-type islets with 1 or 10 µM acetylcholine (n ≥ 5). Acetylcholine treatment is illustrated by black lines. Data are mean ± SEM and were analyzed using one-way ANOVA and Tukey multiple comparison tests (J) or paired t test (I and K). *p < 0.05 and **p < 0.01. See for validation of the nicotinic receptor antibodies.
α Chrnb4 Antibody, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/α chrnb4 antibody/product/Alomone Labs
Average 90 stars, based on 1 article reviews
α chrnb4 antibody - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

93
Alomone Labs rabbit anti human hcn2
Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for HCN1-specific (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, <t>HCN2-specific</t> amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.
Rabbit Anti Human Hcn2, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti human hcn2/product/Alomone Labs
Average 93 stars, based on 1 article reviews
rabbit anti human hcn2 - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

94
Alomone Labs rabbit p2y1
<t>P2Y1</t> and P2X4 receptors activate mitochondria in response to TCR/CD28 stimulation. a Jurkat cells expressing the mitochondrial Ca2+ indicator mito-CAR-GECO1 were pretreated for 10 min with specific antagonists of P2X4 (5-BDBD, 10 μM) or P2Y1 (MRS2279, 10 μM) receptors or with the general P2 receptor antagonist suramin (100 μM). Then, cells were stimulated by TCR/CD28 cross-linking, and changes in mitochondrial Ca2+ uptake were recorded over time using fluorescence microscopy. Traces of individual cells are shown in gray, and the averages of all cells acquired (n = 30–80) are shown in red. Data shown are representative of independent experiments (n ≥ 3). b Averaged mean fluorescence values (+ SEM) of cells (n = 30-80) from different experiments (n ≥ 3 experiments). c Peak mitochondrial Ca2+ levels following TCR/CD28 stimulation; mean ± SEM; *p < 0.05 vs. control, one-way ANOVA
Rabbit P2y1, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit p2y1/product/Alomone Labs
Average 94 stars, based on 1 article reviews
rabbit p2y1 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


scRNA-seq gene body coverage skewness and skewness distribution Three scRNA-seq datasets. (A) Distribution of mapped reads (tags) across genes. Each panel shows the gene body coverage percentile per dataset. The x axis represents the gene body from 5′ end to 3′ end scaled from 0 to 100, and the y axis denotes gene coverage (0–1). lThe plot of the dataset (ArrayExpress: E-MTAB-2600 ) generated by SMARTer protocol (full-length sequence) contains cells with low coverage in the middle of the gene region and cells with high coverage in the 3′ -end of the gene region. Although the dataset (NCBI GEO: GSE29087 ) generated by STRT (5′ -end sequence) contains cells with high coverage both in the middle and the 3′ -end region of the gene. The third dataset from 10x Genomics generated by single-cell 3′ -end protocol contains cells with high coverage in the 5′ -end region of the gene and cells with low coverage in the middle of the gene. (B) Mean of the gene body coverage for different scRNA-seq methods. Error bars represents the standard error of the mean (SEM). (C) Skewness and bias in gene body coverage for cells highlighted with a red dashed box.

Journal: iScience

Article Title: SkewC: Identifying cells with skewed gene body coverage in single-cell RNA sequencing data

doi: 10.1016/j.isci.2022.103777

Figure Lengend Snippet: scRNA-seq gene body coverage skewness and skewness distribution Three scRNA-seq datasets. (A) Distribution of mapped reads (tags) across genes. Each panel shows the gene body coverage percentile per dataset. The x axis represents the gene body from 5′ end to 3′ end scaled from 0 to 100, and the y axis denotes gene coverage (0–1). lThe plot of the dataset (ArrayExpress: E-MTAB-2600 ) generated by SMARTer protocol (full-length sequence) contains cells with low coverage in the middle of the gene region and cells with high coverage in the 3′ -end of the gene region. Although the dataset (NCBI GEO: GSE29087 ) generated by STRT (5′ -end sequence) contains cells with high coverage both in the middle and the 3′ -end region of the gene. The third dataset from 10x Genomics generated by single-cell 3′ -end protocol contains cells with high coverage in the 5′ -end region of the gene and cells with low coverage in the middle of the gene. (B) Mean of the gene body coverage for different scRNA-seq methods. Error bars represents the standard error of the mean (SEM). (C) Skewness and bias in gene body coverage for cells highlighted with a red dashed box.

Article Snippet: We generated our own 10x Genomic Chromium dataset from MCF10A cells (ATCC).

Techniques: Generated, Sequencing

Overview of SkewC workflow The figure illustrates the SkewC workflow and implementation to discriminate skewed cells with skewed gene coverage distribution. The circle numbers callout points to the main inputs, processing, and outputs of SkewC. SkewC inputs are the gene model in. bed format and the aligned reads in BAM format per each cell. For scRNA-seq dataset generated by 10x Genomics libraries, the input to SkewC is the postsorted BAM file together with the cell barcode text file. SkewC bash command to supply the inputs (0_split10XbyBarcode.sh) the batch split the postsorted BAM file into individual BAM files. Compute gene body coverage for each cell. SkewC batch script 1_geneBodyCoverage.sh used to compute gene body coverage and produce a text file.r which contains vector of normalized values. The normalized values are stored as a matrix (coverage matrix with bin size = 100), the coverage matrix should be processed by computing the mean of the coverage matrix and reduce the bin size to be 10. The mean coverage matrix used as in put for the batch script 2_SkewC.sh, which use the trimming clustering function in R (tclust) to cluster the coverage matrix, the script designed to auto approximate the optimal trimming level alpha ( α ) and select the clustering result with optimal alpha ( α ). Other option is to apply the trim clustering with user-defined trimming level alpha ( α ). The output provided in different formats, two text files each with the list of the typical and skewed cells. The other format was R data frame object SkewCAnnotation.rds. The list of annotated single-cells can be added to the R Bioconductor SingleCellExperiment Class or Seurat R package object to be used in QC for filtering skewed cells from analysis.

Journal: iScience

Article Title: SkewC: Identifying cells with skewed gene body coverage in single-cell RNA sequencing data

doi: 10.1016/j.isci.2022.103777

Figure Lengend Snippet: Overview of SkewC workflow The figure illustrates the SkewC workflow and implementation to discriminate skewed cells with skewed gene coverage distribution. The circle numbers callout points to the main inputs, processing, and outputs of SkewC. SkewC inputs are the gene model in. bed format and the aligned reads in BAM format per each cell. For scRNA-seq dataset generated by 10x Genomics libraries, the input to SkewC is the postsorted BAM file together with the cell barcode text file. SkewC bash command to supply the inputs (0_split10XbyBarcode.sh) the batch split the postsorted BAM file into individual BAM files. Compute gene body coverage for each cell. SkewC batch script 1_geneBodyCoverage.sh used to compute gene body coverage and produce a text file.r which contains vector of normalized values. The normalized values are stored as a matrix (coverage matrix with bin size = 100), the coverage matrix should be processed by computing the mean of the coverage matrix and reduce the bin size to be 10. The mean coverage matrix used as in put for the batch script 2_SkewC.sh, which use the trimming clustering function in R (tclust) to cluster the coverage matrix, the script designed to auto approximate the optimal trimming level alpha ( α ) and select the clustering result with optimal alpha ( α ). Other option is to apply the trim clustering with user-defined trimming level alpha ( α ). The output provided in different formats, two text files each with the list of the typical and skewed cells. The other format was R data frame object SkewCAnnotation.rds. The list of annotated single-cells can be added to the R Bioconductor SingleCellExperiment Class or Seurat R package object to be used in QC for filtering skewed cells from analysis.

Article Snippet: We generated our own 10x Genomic Chromium dataset from MCF10A cells (ATCC).

Techniques: Generated, Plasmid Preparation

Effect of GM-CSF on the current amplitude and expression level of Nav1.7, Nav1.8, and Nav1.9 channels. A, Relative mRNA expression of Nav1.7, Nav1.8, Nav1.9, Kv4.2, TMEM16A, P2X3, KCNQ2, and KCNQ3 in cultured DRG cells after incubation of GM-CSF (200 ng/ml) at 24 h (n = 9, unpaired t test, *p < 0.05 compared with the control). B, Relative mRNA expression of Nav1.7, Nav1.8, and Nav1.9 in DRG neurons of bone cancer pain at the seventh day. (n = 6, unpaired t test, *p < 0.05 compared with the control). C, Typical current traces and current density–voltage relationship of total TTX-S, TTX-R, Nav1.8, and Nav1.9 Na+ currents in cultured DRG cells after incubation with GM-CSF (200 ng/ml) for 24 h. D, Western blot analysis of expression levels of Nav1.7, Nav1.8, and Nav1.9 proteins in DRG neurons treated with GM-CSF (200 ng/ml) for 18 h (n = 3, unpaired t test, *p < 0.05 compared with the control).

Journal: The Journal of Neuroscience

Article Title: Transcriptional Regulation of Voltage-Gated Sodium Channels Contributes to GM-CSF-Induced Pain

doi: 10.1523/JNEUROSCI.2204-18.2019

Figure Lengend Snippet: Effect of GM-CSF on the current amplitude and expression level of Nav1.7, Nav1.8, and Nav1.9 channels. A, Relative mRNA expression of Nav1.7, Nav1.8, Nav1.9, Kv4.2, TMEM16A, P2X3, KCNQ2, and KCNQ3 in cultured DRG cells after incubation of GM-CSF (200 ng/ml) at 24 h (n = 9, unpaired t test, *p < 0.05 compared with the control). B, Relative mRNA expression of Nav1.7, Nav1.8, and Nav1.9 in DRG neurons of bone cancer pain at the seventh day. (n = 6, unpaired t test, *p < 0.05 compared with the control). C, Typical current traces and current density–voltage relationship of total TTX-S, TTX-R, Nav1.8, and Nav1.9 Na+ currents in cultured DRG cells after incubation with GM-CSF (200 ng/ml) for 24 h. D, Western blot analysis of expression levels of Nav1.7, Nav1.8, and Nav1.9 proteins in DRG neurons treated with GM-CSF (200 ng/ml) for 18 h (n = 3, unpaired t test, *p < 0.05 compared with the control).

Article Snippet: Membranes were blocked with 5% nonfat dairy milk and incubated with primary antibodies against Nav1.7 (1:500; Alomone Labs), Nav1.8 (1:500; Abcam), Nav1.9 (1:200; Abcam), phospho (p)-Jak1 (1:1000; Affinity), p-Jak2 (1:1000; Affinity), p-Jak3 (1:1000; Affinity), p-stat3 (1:1000; Epitomics), and p-Stat5a (1:1000; Affinity) at 4°C overnight.

Techniques: Expressing, Cell Culture, Incubation, Western Blot

Downregulation of Nav1.7, Nav1.8, and Nav1.9 reverses nociceptive behavior evoked by GM-CSF. A–C, Application of AS ODNs (ASOs) in DRGs against Nav1.7, Nav1.8, and Nav1.9 (each ASO, 12.5 μg/rat, 5 μl) significantly reduced the mRNA expression level of Nav1.7, Nav1.8, and Nav1.9 increased by GM-CSF treatment (A), and alleviated mechanical (B) and thermal hyperalgesia (C) produced by the focal GM-CSF (200 ng) application. For A: n = 6; unpaired t test, *p < 0.05 compared with control; #p < 0.05 with respect to the corresponding GM-CSF. For B, Left, two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,305) = 109.59, p = 0), but not time (F(4,305) = 0.78, p = 0.54) or interaction between the two (F(12,305) = 0.65, p = 0.80). Middle, There was a significant effect of treatment (F(3,305) = 80.53, p = 0), but not time (F(4,305) = 0.20, p = 0.94) or interaction between the two (F(12,305) = 0.42, p = 0.95). Right, There was a significant effect of treatment (F(3,335) = 109.87, p = 0), but not time (F(4,335) = 0.89, p = 0.47) or interaction between the two (F(12,335) = 0.37, p = 0.97). For C, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,295) = 168.25, p = 0) and interaction between treatment and time (F(12,295) = 3.73, p < 0.0001), but the effect of time was not significant (F(4,295) = 1.34, p = 0.25). Middle, There was a significant effect of treatment (F(3,295) = 336.23, p = 0) and an interaction between treatment and time (F(12,295) = 2.04, p = 0.02), but the effect of time was not significant (F(4,295) = 1.05, p = 0.38). Right, There was a significant effect of treatment (F(3,250) = 274.66, p = 0) and interaction between treatment and time (F(12,335) = 5.38, p < 0.0001), but the effect of time was not significant (F(4,335) = 0.71, p = 0.74). *p < 0.05 compared with the vehicle saline; n = 6, #p < 0.05 with respect to the corresponding GM-CSF.

Journal: The Journal of Neuroscience

Article Title: Transcriptional Regulation of Voltage-Gated Sodium Channels Contributes to GM-CSF-Induced Pain

doi: 10.1523/JNEUROSCI.2204-18.2019

Figure Lengend Snippet: Downregulation of Nav1.7, Nav1.8, and Nav1.9 reverses nociceptive behavior evoked by GM-CSF. A–C, Application of AS ODNs (ASOs) in DRGs against Nav1.7, Nav1.8, and Nav1.9 (each ASO, 12.5 μg/rat, 5 μl) significantly reduced the mRNA expression level of Nav1.7, Nav1.8, and Nav1.9 increased by GM-CSF treatment (A), and alleviated mechanical (B) and thermal hyperalgesia (C) produced by the focal GM-CSF (200 ng) application. For A: n = 6; unpaired t test, *p < 0.05 compared with control; #p < 0.05 with respect to the corresponding GM-CSF. For B, Left, two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,305) = 109.59, p = 0), but not time (F(4,305) = 0.78, p = 0.54) or interaction between the two (F(12,305) = 0.65, p = 0.80). Middle, There was a significant effect of treatment (F(3,305) = 80.53, p = 0), but not time (F(4,305) = 0.20, p = 0.94) or interaction between the two (F(12,305) = 0.42, p = 0.95). Right, There was a significant effect of treatment (F(3,335) = 109.87, p = 0), but not time (F(4,335) = 0.89, p = 0.47) or interaction between the two (F(12,335) = 0.37, p = 0.97). For C, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,295) = 168.25, p = 0) and interaction between treatment and time (F(12,295) = 3.73, p < 0.0001), but the effect of time was not significant (F(4,295) = 1.34, p = 0.25). Middle, There was a significant effect of treatment (F(3,295) = 336.23, p = 0) and an interaction between treatment and time (F(12,295) = 2.04, p = 0.02), but the effect of time was not significant (F(4,295) = 1.05, p = 0.38). Right, There was a significant effect of treatment (F(3,250) = 274.66, p = 0) and interaction between treatment and time (F(12,335) = 5.38, p < 0.0001), but the effect of time was not significant (F(4,335) = 0.71, p = 0.74). *p < 0.05 compared with the vehicle saline; n = 6, #p < 0.05 with respect to the corresponding GM-CSF.

Article Snippet: Membranes were blocked with 5% nonfat dairy milk and incubated with primary antibodies against Nav1.7 (1:500; Alomone Labs), Nav1.8 (1:500; Abcam), Nav1.9 (1:200; Abcam), phospho (p)-Jak1 (1:1000; Affinity), p-Jak2 (1:1000; Affinity), p-Jak3 (1:1000; Affinity), p-stat3 (1:1000; Epitomics), and p-Stat5a (1:1000; Affinity) at 4°C overnight.

Techniques: Expressing, Produced

GM-CSF increases the mRNA expression level of Nav1.7, Nav1.8, and Nav1.9 channels through the Jak2–Stat3 signaling pathway. A, Relative expression of p-Jak1, p-Jak2, p-Jak3, p-stat3, and p-stat5 in DRG neurons after incubation with GM-CSF for 25 min (n = 3; unpaired t test, *p < 0.05 compared with control). B, Relative mRNA expression level of Nav1.7, Nav1.8, and Nav1.9 in DRG neurons incubated with GM-CSF in the absence or presence of AG-490 (10 μm) and stattic (20 μm) for 4 h (n = 4–6; unpaired t test, *p < 0.05 compared with control; #p < 0.05 with respect to the corresponding GM-CSF). C, Relative Luciferase activity in HEK 293 cells transfected with reporter vector containing Nav1.7, Nav1.8, and Nav1.9 promoter regions (pGL3) coexpressed with either pcDNA3.1 (control) or pcDNA3.1-Stat3 cDNA (n = 3; unpaired t test, *p < 0.05 compared with control). D–F, Relative mRNA level of Nav1.7, Nav1.8, and Nav1.9 in ipsilateral DRGs (L5) of rats receiving AS ODNs (ASOs) against different Jak and Stat signaling molecules (12.5 mg/rat, 5 μl; n = 6, unpaired t test, *p < 0.05 compared with control; #p < 0.05 with respect to the corresponding GM-CSF). G–I, Effect of ASOs against Jak and Stat signaling molecules (12.5 mg/rat, 5 μl) on hyperalgesia responses to mechanical and thermal stimuli induced by GM-CSF. ASOs were given through the DRG cannula for 4 d, and then GM-CSF (200 ng) was given. For G, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,415) = 125.38, p = 0), but not time (F(4,415) = 0.54, p = 0.70) or interaction between the two (F(12,415) = 0.73, p = 0.73). Right, There was a significant effect of treatment (F(3,425) = 77.18, p = 0), but not time (F(4,425) = 1.24, p = 0.29) or interaction between the two (F(12,425) = 1.65, p = 0.07). For H, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,415) = 110.97, p = 0), but not time (F(4,415) = 0.38, p = 0.82) or interaction between the two (F(12,415) = 0.43, p = 0.79). Right, There was a significant effect of treatment (F(3,440) = 115.88, p = 0), but not time (F(4,440) = 1.40, p = 0.25) or interaction between the two (F(12,440) = 1.13, p = 0.33). For I, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,345) = 143.47, p = 0), but not time (F(4,415) = 0.74, p = 0.57) or interaction between the two (F(12,415) = 0.45, p = 0.94). Right, There was a significant effect of treatment (F(3,440) = 111.32, p = 0), but not time (F(4,440) = 0.88, p = 0.47) or an interaction between the two (F(12,440) = 0.94, p = 0.50). n = 6–8; *p < 0.05 compared with the vehicle saline; #p < 0.05 with respect to the corresponding GM-CSF.

Journal: The Journal of Neuroscience

Article Title: Transcriptional Regulation of Voltage-Gated Sodium Channels Contributes to GM-CSF-Induced Pain

doi: 10.1523/JNEUROSCI.2204-18.2019

Figure Lengend Snippet: GM-CSF increases the mRNA expression level of Nav1.7, Nav1.8, and Nav1.9 channels through the Jak2–Stat3 signaling pathway. A, Relative expression of p-Jak1, p-Jak2, p-Jak3, p-stat3, and p-stat5 in DRG neurons after incubation with GM-CSF for 25 min (n = 3; unpaired t test, *p < 0.05 compared with control). B, Relative mRNA expression level of Nav1.7, Nav1.8, and Nav1.9 in DRG neurons incubated with GM-CSF in the absence or presence of AG-490 (10 μm) and stattic (20 μm) for 4 h (n = 4–6; unpaired t test, *p < 0.05 compared with control; #p < 0.05 with respect to the corresponding GM-CSF). C, Relative Luciferase activity in HEK 293 cells transfected with reporter vector containing Nav1.7, Nav1.8, and Nav1.9 promoter regions (pGL3) coexpressed with either pcDNA3.1 (control) or pcDNA3.1-Stat3 cDNA (n = 3; unpaired t test, *p < 0.05 compared with control). D–F, Relative mRNA level of Nav1.7, Nav1.8, and Nav1.9 in ipsilateral DRGs (L5) of rats receiving AS ODNs (ASOs) against different Jak and Stat signaling molecules (12.5 mg/rat, 5 μl; n = 6, unpaired t test, *p < 0.05 compared with control; #p < 0.05 with respect to the corresponding GM-CSF). G–I, Effect of ASOs against Jak and Stat signaling molecules (12.5 mg/rat, 5 μl) on hyperalgesia responses to mechanical and thermal stimuli induced by GM-CSF. ASOs were given through the DRG cannula for 4 d, and then GM-CSF (200 ng) was given. For G, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,415) = 125.38, p = 0), but not time (F(4,415) = 0.54, p = 0.70) or interaction between the two (F(12,415) = 0.73, p = 0.73). Right, There was a significant effect of treatment (F(3,425) = 77.18, p = 0), but not time (F(4,425) = 1.24, p = 0.29) or interaction between the two (F(12,425) = 1.65, p = 0.07). For H, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,415) = 110.97, p = 0), but not time (F(4,415) = 0.38, p = 0.82) or interaction between the two (F(12,415) = 0.43, p = 0.79). Right, There was a significant effect of treatment (F(3,440) = 115.88, p = 0), but not time (F(4,440) = 1.40, p = 0.25) or interaction between the two (F(12,440) = 1.13, p = 0.33). For I, Left, Two-way ANOVA followed by Bonferroni post hoc tests revealed a significant effect of treatment (F(3,345) = 143.47, p = 0), but not time (F(4,415) = 0.74, p = 0.57) or interaction between the two (F(12,415) = 0.45, p = 0.94). Right, There was a significant effect of treatment (F(3,440) = 111.32, p = 0), but not time (F(4,440) = 0.88, p = 0.47) or an interaction between the two (F(12,440) = 0.94, p = 0.50). n = 6–8; *p < 0.05 compared with the vehicle saline; #p < 0.05 with respect to the corresponding GM-CSF.

Article Snippet: Membranes were blocked with 5% nonfat dairy milk and incubated with primary antibodies against Nav1.7 (1:500; Alomone Labs), Nav1.8 (1:500; Abcam), Nav1.9 (1:200; Abcam), phospho (p)-Jak1 (1:1000; Affinity), p-Jak2 (1:1000; Affinity), p-Jak3 (1:1000; Affinity), p-stat3 (1:1000; Epitomics), and p-Stat5a (1:1000; Affinity) at 4°C overnight.

Techniques: Expressing, Incubation, Luciferase, Activity Assay, Transfection, Plasmid Preparation

KEY RESOURCES TABLE

Journal: Cell reports

Article Title: NKD2 mediates stimulation-dependent ORAI1 trafficking to augment Ca 2+ entry in T cells

doi: 10.1016/j.celrep.2021.109603

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: Human ORAI1 (flow cytometry) , Alomone Labs , Cat# ACC-060; ACC-060-F.

Techniques: FLAG-tag, Western Blot, Flow Cytometry, Recombinant, Staining, Plasmid Preparation, Software, Imaging, Microscopy

Cross-reactivity Kir6.2-Kir6.1. (A) Staining of Kir6.1 (green; APC-105; Alomone Labs) and Kir6.2 (red; APC-020; Alomone Labs) in the same section of mouse brain tissue. Kir6.1 shows labeling in blood vessel-like structures and Kir6.2 in neuronal-like structures. This shows that the Kir6.2 antibody does not cross-react with the Kir6.1 epitope. (B) Western blot analysis of a lysate of HEK293T-cells transfected with an empty vector (lane 1) and HEK293T cells that overexpress Kir6.1 (NBL1-12174; Novus Biological, Littleton, CO) (lane 2). The membrane shown on the left was incubated with an anti-Kir6.1 antibody and the one on the right with an anti-Kir6.2 antibody. Only the Kir6.1 antibody was detecting the HEK293T-cells lysate showing that cross-reactivity does not occur between the Kir6.2 antibody and the Kir6.1 epitope.

Journal: Journal of Neurotrauma

Article Title: Kir6.2, the Pore-Forming Subunit of ATP-Sensitive K + Channels, Is Overexpressed in Human Posttraumatic Brain Contusions

doi: 10.1089/neu.2017.5619

Figure Lengend Snippet: Cross-reactivity Kir6.2-Kir6.1. (A) Staining of Kir6.1 (green; APC-105; Alomone Labs) and Kir6.2 (red; APC-020; Alomone Labs) in the same section of mouse brain tissue. Kir6.1 shows labeling in blood vessel-like structures and Kir6.2 in neuronal-like structures. This shows that the Kir6.2 antibody does not cross-react with the Kir6.1 epitope. (B) Western blot analysis of a lysate of HEK293T-cells transfected with an empty vector (lane 1) and HEK293T cells that overexpress Kir6.1 (NBL1-12174; Novus Biological, Littleton, CO) (lane 2). The membrane shown on the left was incubated with an anti-Kir6.1 antibody and the one on the right with an anti-Kir6.2 antibody. Only the Kir6.1 antibody was detecting the HEK293T-cells lysate showing that cross-reactivity does not occur between the Kir6.2 antibody and the Kir6.1 epitope.

Article Snippet: Alomone's APC-020 is an affinity purified, polyclonal rabbit antibody raised against amino acid sequence 372-385 of rat Kir6.2, which is homologous to human Kir6.2.

Techniques: Staining, Labeling, Western Blot, Transfection, Plasmid Preparation, Incubation

TRPM7/TRPM6 protein expression and TRPM7 kinase activity in splenic T cells. ( A ) Western blot analysis of immunoprecipitated TRPM7 from whole cell lysates of WT and KD splenic T cells. T cells were stimulated with PMA/ionomycin or anti-CD3/CD28 antibody coated beads for 48 hrs. Mouse embryonic fibroblasts were used as a positive control. Equal amounts of protein before immunoprecipitation were ensured by probing for actin. ( B ) Incorporation of 32 P into exogenous myelin basic protein (MBP) by TRPM7 immunoprecipitated from WT and KD resting T cells. Equal quantities of MBP were verified by coomassie blue staining. ( C ) Control experiment showing that anti-TRPM6 antibody was able to recognize TRPM6, by immunoprecipitation using anti-TRPM6 antibody in GFP-TRPM6 transfected HEK cells ( D ). Western blot analysis of TRPM6 immunoprecipitated from WT and KD mouse T cells and kidneys. Full gel images are provided in Supplementary Fig. .

Journal: Scientific Reports

Article Title: Inactivation of TRPM7 kinase in mice results in enlarged spleens, reduced T-cell proliferation and diminished store-operated calcium entry

doi: 10.1038/s41598-018-21004-w

Figure Lengend Snippet: TRPM7/TRPM6 protein expression and TRPM7 kinase activity in splenic T cells. ( A ) Western blot analysis of immunoprecipitated TRPM7 from whole cell lysates of WT and KD splenic T cells. T cells were stimulated with PMA/ionomycin or anti-CD3/CD28 antibody coated beads for 48 hrs. Mouse embryonic fibroblasts were used as a positive control. Equal amounts of protein before immunoprecipitation were ensured by probing for actin. ( B ) Incorporation of 32 P into exogenous myelin basic protein (MBP) by TRPM7 immunoprecipitated from WT and KD resting T cells. Equal quantities of MBP were verified by coomassie blue staining. ( C ) Control experiment showing that anti-TRPM6 antibody was able to recognize TRPM6, by immunoprecipitation using anti-TRPM6 antibody in GFP-TRPM6 transfected HEK cells ( D ). Western blot analysis of TRPM6 immunoprecipitated from WT and KD mouse T cells and kidneys. Full gel images are provided in Supplementary Fig. .

Article Snippet: Extracts of T cells, mouse embryonic fibroblasts (MEF) or HEK293 cells (untransfected or heterologously expressing GFP tagged human TRPM6 in pEGFP-C1 vector) were obtained as described above for the TRPM7 kinase assay and incubated with anti-TRPM7 antibody (1:500) or anti-TRPM6 antibody (1:500, ACC-046; Alomone labs, Israel) overnight at 4 °C, followed by incubation with protein A sepharose beads for 1 hr.

Techniques: Expressing, Activity Assay, Western Blot, Immunoprecipitation, Positive Control, Staining, Transfection

Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for HCN1-specific (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for HCN1-specific (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Binding Assay, Sequencing, Construct

Interaction of HCN1 amino-terminal region with binding partners Rate constants for association and dissociation (mean ± S.E., n = 3 for each value) were obtained from original surface plasmon resonance plots by the use of BIAevaluation software (Biacore, Piscataway, NJ). Best fits of curves were determined corresponding to a Langmuir binding model ( 62 ). Equilibrium binding constants were calculated from the ratio of means of the rate constants. “Specific” HCN1-N (HCN1 amino-terminal sequence) included aa 1–78, and “full” HCN1-N encompassed aa 1–127. Ca 2+ concentration was 100 μ m for binding between  HCN1-specific  amino terminus and HCN1 full-length amino terminus and protocadherin 15 CD3. Experiments carried out examining binding between  HCN1-specific  amino terminus and phospholipids included Ca 2+ at 92 μ m . Kinetic constants for phospholipid binding were determined with HCN1 as analyte and phospholipid as ligand. PCDH CD3, protocadherin 15 CD3.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Interaction of HCN1 amino-terminal region with binding partners Rate constants for association and dissociation (mean ± S.E., n = 3 for each value) were obtained from original surface plasmon resonance plots by the use of BIAevaluation software (Biacore, Piscataway, NJ). Best fits of curves were determined corresponding to a Langmuir binding model ( 62 ). Equilibrium binding constants were calculated from the ratio of means of the rate constants. “Specific” HCN1-N (HCN1 amino-terminal sequence) included aa 1–78, and “full” HCN1-N encompassed aa 1–127. Ca 2+ concentration was 100 μ m for binding between HCN1-specific amino terminus and HCN1 full-length amino terminus and protocadherin 15 CD3. Experiments carried out examining binding between HCN1-specific amino terminus and phospholipids included Ca 2+ at 92 μ m . Kinetic constants for phospholipid binding were determined with HCN1 as analyte and phospholipid as ligand. PCDH CD3, protocadherin 15 CD3.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Binding Assay, SPR Assay, Software, Sequencing, Concentration Assay

Interaction between the HCN1-specific amino terminus with PIP3 and PIP2. A, rat olfactory CNGA2 amino terminus: residues 61–90 (highlighted in yellow) are necessary for PIP3 binding and suppression of CNG channel currents (arginine residues putatively used in CNGA2 binding to PIP3 are highlighted in blue). Bold italicized sequence is first membrane spanning region. Rat HCN1 amino terminus: positively charged aa residues putatively involved in lipid binding are highlighted in blue. HCN1 amino terminus: sequence that is conserved across HCN isoforms is boldface and underlined. B, membrane lipid strip analysis of binding to the specific, nonconserved amino terminus of rat HCN1. Of the 16 lipid components, binding was observed for PIP3 and PIP2. C, SPR for interaction of HCN1 and phospholipids is as follows: bar 1, PIP2 + Ca2+; bar 2, PIP2 + EGTA; bar 3, PIP3 + Ca2+; bar 4, PIP3 + EGTA; bar 5, buffer; means ± S.E. are indicated. ***, PIP2 + Ca2+ versus PIP2 + EGTA, p < 0.01; ****, PIP3 + Ca2+ versus PIP3 + EGTA, p < 0.001 (two-tailed t test for difference of means for small samples, n = 5). The cytoplasmic amino terminus of rat HCN1 was expressed and purified as a histidine-tagged fusion peptide and used as ligand in surface plasmon resonance analysis on a CM5 sensor chip. 10 μm of each phosphatidylinositol served as analyte in either 92 μm Ca2+ or 1 mm EGTA. Three experiments were carried out, each with n = 5, yielding similar results. D, representative sensorgrams showing interaction of rat HCN1-specific amino terminus (ligand) with PIP3 (10 μm) (analyte) in either 92 μm Ca2+ (black) or in 1 mm EGTA (pink). E, representative sensorgram illustrating interaction of PIP2 (10 μm) (analyte) in either 92 μm Ca2+ (black) or 1 mm EGTA (green) with HCN1-specific amino terminus (ligand). D and E, five SPR determinations were performed for each condition/construct per experiment, and multiple experiments were carried out. RU, response units.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Interaction between the HCN1-specific amino terminus with PIP3 and PIP2. A, rat olfactory CNGA2 amino terminus: residues 61–90 (highlighted in yellow) are necessary for PIP3 binding and suppression of CNG channel currents (arginine residues putatively used in CNGA2 binding to PIP3 are highlighted in blue). Bold italicized sequence is first membrane spanning region. Rat HCN1 amino terminus: positively charged aa residues putatively involved in lipid binding are highlighted in blue. HCN1 amino terminus: sequence that is conserved across HCN isoforms is boldface and underlined. B, membrane lipid strip analysis of binding to the specific, nonconserved amino terminus of rat HCN1. Of the 16 lipid components, binding was observed for PIP3 and PIP2. C, SPR for interaction of HCN1 and phospholipids is as follows: bar 1, PIP2 + Ca2+; bar 2, PIP2 + EGTA; bar 3, PIP3 + Ca2+; bar 4, PIP3 + EGTA; bar 5, buffer; means ± S.E. are indicated. ***, PIP2 + Ca2+ versus PIP2 + EGTA, p < 0.01; ****, PIP3 + Ca2+ versus PIP3 + EGTA, p < 0.001 (two-tailed t test for difference of means for small samples, n = 5). The cytoplasmic amino terminus of rat HCN1 was expressed and purified as a histidine-tagged fusion peptide and used as ligand in surface plasmon resonance analysis on a CM5 sensor chip. 10 μm of each phosphatidylinositol served as analyte in either 92 μm Ca2+ or 1 mm EGTA. Three experiments were carried out, each with n = 5, yielding similar results. D, representative sensorgrams showing interaction of rat HCN1-specific amino terminus (ligand) with PIP3 (10 μm) (analyte) in either 92 μm Ca2+ (black) or in 1 mm EGTA (pink). E, representative sensorgram illustrating interaction of PIP2 (10 μm) (analyte) in either 92 μm Ca2+ (black) or 1 mm EGTA (green) with HCN1-specific amino terminus (ligand). D and E, five SPR determinations were performed for each condition/construct per experiment, and multiple experiments were carried out. RU, response units.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Binding Assay, Sequencing, Stripping Membranes, Two Tailed Test, Purification, SPR Assay, Construct

Amplification of HCN1 and HCN2 cDNA from cochlear inner and outer hair cells. A, agarose gel for HCN1 PCR indicating amplification from the cochlear inner and outer hair cell cDNA of predicted 397-bp product crossing intron (white arrows). Nucleotide sequencing of uncloned rat HCN1 amplification product from cochlear IHC indicated 100% identity to rat HCN1. Nested primers applied in PCR to the OHC 397-bp product elicited amplification of HCN1 cDNA with 100% identity to rat HCN1 nucleotide sequence. The adjacent lanes (IHC and OHC) with a second set of primers for HCN1 yielded negative results. B, agarose gel for amplification of HCN2 cDNA from rat cochlear outer hair cells (209 bp, crossing intron, black arrow) with 100% nucleotide identity to rat HCN2. S, 1-kb standards; B, water blanks.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Amplification of HCN1 and HCN2 cDNA from cochlear inner and outer hair cells. A, agarose gel for HCN1 PCR indicating amplification from the cochlear inner and outer hair cell cDNA of predicted 397-bp product crossing intron (white arrows). Nucleotide sequencing of uncloned rat HCN1 amplification product from cochlear IHC indicated 100% identity to rat HCN1. Nested primers applied in PCR to the OHC 397-bp product elicited amplification of HCN1 cDNA with 100% identity to rat HCN1 nucleotide sequence. The adjacent lanes (IHC and OHC) with a second set of primers for HCN1 yielded negative results. B, agarose gel for amplification of HCN2 cDNA from rat cochlear outer hair cells (209 bp, crossing intron, black arrow) with 100% nucleotide identity to rat HCN2. S, 1-kb standards; B, water blanks.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Amplification, Agarose Gel Electrophoresis, Sequencing

z-Stack confocal immunofluorescence analysis of HCN1 and HCN2 protein expression in the organ of Corti of the adult mouse. A and B, three-dimensional reconstruction of 43 1-μm confocal optical slices, indicating immunofluorescence (red) for HCN1 (Abcam 1:50) and HCN2 (green) (Alomone, 1:200) in the organ of Corti of the adult mouse. Immunofluorescence for HCN1 was localized to stereociliary arrays for outer hair cells, which in the reconstruction extended to subcuticular sites (A, short arrow). Immunofluorescence (red) for inner hair cell stereociliary regions was visible but more sparse (A, arrowhead). HCN2 immunoreactivity (green) co-localized with HCN1 in afferents beneath the inner hair cells (A and B, yellow, long arrows). Afferents beneath outer hair cells contained primarily immunofluorescence for HCN1 (A and B, red, medium arrows). The situation that was set up was potentially one of possible competition between HCN1 and HCN2 primary antibodies. Regions of intense immunoreactivity for HCN2 appeared adjacent to the outer hair cells, consistent in position to extensions of Deiters' cells (A, short arrow with dot). Scale bars for A and B, 20 μm. B, second position of three-dimensional reconstruction of z-stack confocal optical slices. The results were consistent with differential distribution of HCN1 and HCN2 in cells of the organ of Corti and differential expression at intracellular sites. C, 1-μm optical section 3 μm in from beginning position of the z-stack, illustrating HCN1 immunofluorescence (red, Santa Cruz Biotechnology) in cochlear outer hair cell stereociliary arrays, with arrows pointing to two individual inner rows of stereocilia in the stereociliary array. Scale bars for C–E, 4 μm. D, 1-μm optical section (paired with C), showing HCN2 immunofluorescence (green, Alomone) in OHC stereocilia (arrow). E, confocally determined overlap (yellow) of HCN1 (C) with HCN2 (D) in stereocilia of OHC (arrow). F, z-stack confocal imaging of HCN2 immunofluorescence (green) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow), 0.3-μm optical section (0.6 μm into z-stack) for HCN2 and phalloidin combination. Scale bars for F–H, 20 μm. G, rhodamine-coupled phalloidin detection of F-actin (red) in cochlear hair cell stereocilia. H, confocal overlap of HCN2 with phalloidin (yellow) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow). I, magnified view of HCN2 overlap with phalloidin in IHC stereocilia (arrow). Scale bar, 10 μm.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: z-Stack confocal immunofluorescence analysis of HCN1 and HCN2 protein expression in the organ of Corti of the adult mouse. A and B, three-dimensional reconstruction of 43 1-μm confocal optical slices, indicating immunofluorescence (red) for HCN1 (Abcam 1:50) and HCN2 (green) (Alomone, 1:200) in the organ of Corti of the adult mouse. Immunofluorescence for HCN1 was localized to stereociliary arrays for outer hair cells, which in the reconstruction extended to subcuticular sites (A, short arrow). Immunofluorescence (red) for inner hair cell stereociliary regions was visible but more sparse (A, arrowhead). HCN2 immunoreactivity (green) co-localized with HCN1 in afferents beneath the inner hair cells (A and B, yellow, long arrows). Afferents beneath outer hair cells contained primarily immunofluorescence for HCN1 (A and B, red, medium arrows). The situation that was set up was potentially one of possible competition between HCN1 and HCN2 primary antibodies. Regions of intense immunoreactivity for HCN2 appeared adjacent to the outer hair cells, consistent in position to extensions of Deiters' cells (A, short arrow with dot). Scale bars for A and B, 20 μm. B, second position of three-dimensional reconstruction of z-stack confocal optical slices. The results were consistent with differential distribution of HCN1 and HCN2 in cells of the organ of Corti and differential expression at intracellular sites. C, 1-μm optical section 3 μm in from beginning position of the z-stack, illustrating HCN1 immunofluorescence (red, Santa Cruz Biotechnology) in cochlear outer hair cell stereociliary arrays, with arrows pointing to two individual inner rows of stereocilia in the stereociliary array. Scale bars for C–E, 4 μm. D, 1-μm optical section (paired with C), showing HCN2 immunofluorescence (green, Alomone) in OHC stereocilia (arrow). E, confocally determined overlap (yellow) of HCN1 (C) with HCN2 (D) in stereocilia of OHC (arrow). F, z-stack confocal imaging of HCN2 immunofluorescence (green) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow), 0.3-μm optical section (0.6 μm into z-stack) for HCN2 and phalloidin combination. Scale bars for F–H, 20 μm. G, rhodamine-coupled phalloidin detection of F-actin (red) in cochlear hair cell stereocilia. H, confocal overlap of HCN2 with phalloidin (yellow) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow). I, magnified view of HCN2 overlap with phalloidin in IHC stereocilia (arrow). Scale bar, 10 μm.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Immunofluorescence, Expressing, Imaging

Pre-embedding immunogold detection of HCN1 and HCN2 in hair cells of the organ of Corti in the adult rat. A and B, HCN1 immunogold (Alomone antibody) is found at apical and lateral sites on stereocilia of outer hair cells (arrows) (magnified in A1) not dissimilar in position to that reported for tip-link proteins (4). Also note that HCN1 immunogold in A is concentrated at subcuticular plate sites (short arrows) of outer hair cells (magnified in A2). Scale bars, 500 nm for A; 250 nm for A1 and A2; 100 nm for B. C, HCN1 immunogold (arrows, Alomone primary antibody) is localized in IHC to filaments extending at lateral positions, possibly cross-connecting stereocilia. Scale bar, 300 nm. Magnified view is shown in supplemental Fig. 3A. D, HCN1 immunogold (arrows, Alomone primary antibody) was found in type II afferent endings (A) on OHC (H), as was observed with confocal immunofluorescence with a different HCN1 antibody (Abcam) and different rodent (mouse). Scale bar, 200 nm. Magnified view is shown in supplemental Fig. 3B; HCN2 immunogold was found at lateral positions on taller stereocilia of OHC in the adult rat (E, arrows; magnified in E1) as well as at sites at the top of shorter stereocilia (F–I, arrows). As with HCN1, immunogold for HCN2 was also found at sites beneath the cuticular plate (E, short arrows, magnified in E2), but unlike HCN1, HCN2 was not found in type II afferent dendrites at the base of OHC (not illustrated), consistent with results from confocal microscopy. Scales bars, 500 nm for E; 250 nm for E1; 100 nm for E2, and F–I.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Pre-embedding immunogold detection of HCN1 and HCN2 in hair cells of the organ of Corti in the adult rat. A and B, HCN1 immunogold (Alomone antibody) is found at apical and lateral sites on stereocilia of outer hair cells (arrows) (magnified in A1) not dissimilar in position to that reported for tip-link proteins (4). Also note that HCN1 immunogold in A is concentrated at subcuticular plate sites (short arrows) of outer hair cells (magnified in A2). Scale bars, 500 nm for A; 250 nm for A1 and A2; 100 nm for B. C, HCN1 immunogold (arrows, Alomone primary antibody) is localized in IHC to filaments extending at lateral positions, possibly cross-connecting stereocilia. Scale bar, 300 nm. Magnified view is shown in supplemental Fig. 3A. D, HCN1 immunogold (arrows, Alomone primary antibody) was found in type II afferent endings (A) on OHC (H), as was observed with confocal immunofluorescence with a different HCN1 antibody (Abcam) and different rodent (mouse). Scale bar, 200 nm. Magnified view is shown in supplemental Fig. 3B; HCN2 immunogold was found at lateral positions on taller stereocilia of OHC in the adult rat (E, arrows; magnified in E1) as well as at sites at the top of shorter stereocilia (F–I, arrows). As with HCN1, immunogold for HCN2 was also found at sites beneath the cuticular plate (E, short arrows, magnified in E2), but unlike HCN1, HCN2 was not found in type II afferent dendrites at the base of OHC (not illustrated), consistent with results from confocal microscopy. Scales bars, 500 nm for E; 250 nm for E1; 100 nm for E2, and F–I.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Immunofluorescence, Confocal Microscopy

Expression of transcript and protein in the HCN1 mutant, HCN1−/− (8). A, diagrammatic representation of HCN1 with primer positions for RT-PCR amplification of the amino-terminal cDNA indicated by black arrows 1 and 2 (upstream primer gggatggctgtcttcagttcctg; downstream primer ccacaagttaccagctgaca, Δ379 bp). Black arrows 3 and 4 designate primers encompassing the pore and S6 transmembrane domains (upstream primer atggaaggcggcggcaaacccaa; downstream primer gcaggcttctggattatccatccg, Δ120 bp). Amino- and carboxyl-terminal positions of HCN1 amino acid sequence targeted by primary antibodies in Western blots (Fig. 8, F and G) are indicated by red vertical arrows, respectively. B, agarose gel separation of cDNA products amplified from brain cDNA of the HCN1−/− mutant mouse with primers situated in front and back of the in-frame deletion of the pore filter + S6 transmembrane domain. Lanes 1 and 2 are water blanks; lane 3, standards; lanes 4–6 replicates with predicted 120-bp products; lanes 7 and 8, −RTs). C, agarose gel separation of cDNA amplified (379 bp) from brain of HCN1−/− for full amino terminus of HCN1; lane 1, −RT; lane 2, standards; lanes 3–5, three separate + RT preparations; lane 6, water blank; and lane 7, −RT. D, arrow shows splice location between exons 3 and 5 (exon 4 is deleted in the knock-out) in contiguous nucleotide sequence of HCN1 in brain cDNA for HCN1−/− mutant. E, HCN1 wild-type amino acid sequence is presented. Transmembrane regions are highlighted in yellow. The underlined sequence, including exon 4 (boldface), is deleted in HCN1−/−. The pore is highlighted in blue; the S6 transmembrane region (underlined) is highlighted in yellow. Contiguous amino acid sequence in HCN1−/− is in pink. F and G, Western blots demonstrating protein fragments of HCN1 remaining in brain (35-μg quantities) of HCN1−/− as determined by the HCN1 amino-terminal targeting antibody (F, Alomone primary antibody raised in rabbit) and HCN1 carboxyl-terminal targeting antibody (G, Santa Cruz Biotechnology primary antibody raised in goat), evidence of full-length protein translation minus the pore + S6. Red arrows show doublet bands, present in both blots, representing longest fragments consistent with predicted mass for HCN1 in HCN1−/− mutant of 93.6 kDa (lower band) and presumably a glycosylated version (10) (upper band). H, IgG negative controls, left panel, Western blots of HCN1−/− brain lysate probed with equivalent amounts of rabbit IgG (R-IgG) as used in F, and right panel, equivalent goat IgG (G-IgG) as used in G. For F–H, C = Western negative control with brain lysate, secondary antibody, but no primary antibody. STD = standards.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Expression of transcript and protein in the HCN1 mutant, HCN1−/− (8). A, diagrammatic representation of HCN1 with primer positions for RT-PCR amplification of the amino-terminal cDNA indicated by black arrows 1 and 2 (upstream primer gggatggctgtcttcagttcctg; downstream primer ccacaagttaccagctgaca, Δ379 bp). Black arrows 3 and 4 designate primers encompassing the pore and S6 transmembrane domains (upstream primer atggaaggcggcggcaaacccaa; downstream primer gcaggcttctggattatccatccg, Δ120 bp). Amino- and carboxyl-terminal positions of HCN1 amino acid sequence targeted by primary antibodies in Western blots (Fig. 8, F and G) are indicated by red vertical arrows, respectively. B, agarose gel separation of cDNA products amplified from brain cDNA of the HCN1−/− mutant mouse with primers situated in front and back of the in-frame deletion of the pore filter + S6 transmembrane domain. Lanes 1 and 2 are water blanks; lane 3, standards; lanes 4–6 replicates with predicted 120-bp products; lanes 7 and 8, −RTs). C, agarose gel separation of cDNA amplified (379 bp) from brain of HCN1−/− for full amino terminus of HCN1; lane 1, −RT; lane 2, standards; lanes 3–5, three separate + RT preparations; lane 6, water blank; and lane 7, −RT. D, arrow shows splice location between exons 3 and 5 (exon 4 is deleted in the knock-out) in contiguous nucleotide sequence of HCN1 in brain cDNA for HCN1−/− mutant. E, HCN1 wild-type amino acid sequence is presented. Transmembrane regions are highlighted in yellow. The underlined sequence, including exon 4 (boldface), is deleted in HCN1−/−. The pore is highlighted in blue; the S6 transmembrane region (underlined) is highlighted in yellow. Contiguous amino acid sequence in HCN1−/− is in pink. F and G, Western blots demonstrating protein fragments of HCN1 remaining in brain (35-μg quantities) of HCN1−/− as determined by the HCN1 amino-terminal targeting antibody (F, Alomone primary antibody raised in rabbit) and HCN1 carboxyl-terminal targeting antibody (G, Santa Cruz Biotechnology primary antibody raised in goat), evidence of full-length protein translation minus the pore + S6. Red arrows show doublet bands, present in both blots, representing longest fragments consistent with predicted mass for HCN1 in HCN1−/− mutant of 93.6 kDa (lower band) and presumably a glycosylated version (10) (upper band). H, IgG negative controls, left panel, Western blots of HCN1−/− brain lysate probed with equivalent amounts of rabbit IgG (R-IgG) as used in F, and right panel, equivalent goat IgG (G-IgG) as used in G. For F–H, C = Western negative control with brain lysate, secondary antibody, but no primary antibody. STD = standards.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Expressing, Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Amplification, Sequencing, Western Blot, Agarose Gel Electrophoresis, Knock-Out, Negative Control

Quantitative PCR analysis of HCN isoform expression in organ of Corti of adult mouse for wild type and HCN1−/−. A, agarose gel resolution of PCR product for full-length HCN1 cDNA in organ of Corti for control (lane 2, predicted Δ = 2,363 bp) versus mutant (lane 3, predicted Δ = 2,144 bp), demonstrating full-length sequence in mutant with the in-frame deletion. B, nucleotide sequence for organ of Corti HCN1 in the HCN1−/−, demonstrating again, as for brain, contiguous mRNA sequence before and after the in-frame deletion of the pore filter and sixth trans-membrane region. Arrow shows splice location between exons 3 and 5 (exon 4 is deleted in the mutant). C, quantitative PCR for HCN isoforms in morphologically defined mouse cochlear organ of Corti subfraction (6) for HCN1−/− versus control. *** indicates p = 0.0026 for HCN1 in HCN1 mutant versus control ΔCt by unpaired, two-tailed t test. * indicates p = 0.054 for HCN2 in HCN1 mutant versus control. Five sets of experiments each with two replicates per point.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Quantitative PCR analysis of HCN isoform expression in organ of Corti of adult mouse for wild type and HCN1−/−. A, agarose gel resolution of PCR product for full-length HCN1 cDNA in organ of Corti for control (lane 2, predicted Δ = 2,363 bp) versus mutant (lane 3, predicted Δ = 2,144 bp), demonstrating full-length sequence in mutant with the in-frame deletion. B, nucleotide sequence for organ of Corti HCN1 in the HCN1−/−, demonstrating again, as for brain, contiguous mRNA sequence before and after the in-frame deletion of the pore filter and sixth trans-membrane region. Arrow shows splice location between exons 3 and 5 (exon 4 is deleted in the mutant). C, quantitative PCR for HCN isoforms in morphologically defined mouse cochlear organ of Corti subfraction (6) for HCN1−/− versus control. *** indicates p = 0.0026 for HCN1 in HCN1 mutant versus control ΔCt by unpaired, two-tailed t test. * indicates p = 0.054 for HCN2 in HCN1 mutant versus control. Five sets of experiments each with two replicates per point.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Real-time Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Mutagenesis, Sequencing, Two Tailed Test

Immunoprecipitation by primary antibodies to filamin A, HCN2, and fascin-2. Immunoreactivity for filamin A detected by DAB (A) and immunofluorescence (B) (mouse MAB1678 raised to human filamin A crossing to rat; 1:1,000, clone PM6/317, Chemicon) was localized to stereocilia of both inner hair cells (long arrows) and outer hair cells (short arrows) in rat cochlea. Scale bars for A and B, 10 μm. C, lane 1, full-length filamin A (detected with filamin A primary antibody 1:1,000) in immunoprecipitation complex arising from the use of anti-filamin A for immunoprecipitation (1:100) from rat brain lysate. This antibody recognizes unprocessed filamin A (270–280 kDa, arrow, as well as 170-, 150-, and 120-kDa cleavage fragments (Chemicon)). Lane 2, negative control with brain lysate, without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, standards. D, additional negative control for C. Immunoprecipitation with mouse IgG as negative control probed with antifilamin A. Lane 1, mouse IgG immunoprecipitation of brain lysate + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 2, mouse IgG (no immunoprecipitation) + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 3, denatured mouse IgG electrophoresis, probed with filamin A primary + donkey anti-mouse secondary. No protein was observed corresponding to molecular mass of filamin A (arrow). E, Western blot of HCN1 (104 kDa, arrow) in rat brain lysate (1:50, sc-19706, Santa Cruz Biotechnology), lane 1; lane 2, standards. F, immunoprecipitation by anti-filamin A of full-length HCN1. Lane 1, standards; lane 2, negative control with brain lysate without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, HCN1 immunoprecipitated with anti-filamin A (arrow, 104 kDa), detected with goat anti-mouse HCN1 (carboxyl terminus) which crosses to rat HCN1 sequence (sc-19706 Santa Cruz Biotechnology). G, complex of filamin A and HCN1 also contained protocadherin 15 CD3. Lane 1, standards; lane 2, full-length protocadherin 15 CD3 (189 kDa, arrow) immunoprecipitated with anti-filamin A detected with custom primary antibody (1:10,000) (arrow). Goat anti-chick IgY-HRP (Santa Cruz Biotechnology) was used as the secondary antibody (1:10,000). Lane 3, negative control without anti-filamin A immunoprecipitation but with brain lysate and protein A beads and primary and secondary antibodies. H, Western blot of HCN2 in rat brain lysate. Lane 1, standards; lane 2, HCN2 detected with a rabbit polyclonal antibody (1:200, Alomone). Predicted molecular masses of 95 and 127 kDa corresponding to unglycosylated (arrow) and glycosylated HCN2, respectively. I, HCN2 is not detected in the complex immunoprecipitated by anti-filamin A. Lane 1, standards; lane 2, HCN2 bands observed in Western (H) are not detected in immunoprecipitated complex. Bands at 170–180 kDa may correspond to protocadherin 15 CD3, given that 5 of 15 aa in the epitope targeted by the HCN2 antibody are identical in protocadherin 15 CD3, and further given that protocadherin 15 CD3 is highly concentrated in the complex immunoprecipitated by anti-filamin A (G). J, anti-HCN2 immunoprecipitates HCN1 from rat brain lysate. Lane 1, standards; lane 2, anti-HCN2 primary antibody (1:33, Alomone) immunoprecipitates HCN1 unglycosylated (104 kDa, arrow) and glycosylated (120 and 130 kDa) forms detected with anti-HCN1 primary antibody (Santa Cruz Biotechnology); lane 3, negative control for immunoprecipitation with all components except anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). K, anti-HCN2 immunoprecipitation of HCN1 complex does not include protocadherin 15 CD3. Lane 1, standards; lane 2, anti-protocadherin 15 CD3 primary antibody (1:7,500), goat anti-chick secondary antibody (1:5,000); lane 3, negative control without anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). No bands were evident for either experimental (lane 2) or negative control (lane 3) with goat anti-chick IgY as the secondary antibody. In a second protocol, a bovine anti-chick secondary antibody (1:5,000) detected an ∼170-kDa protein in both experimental and negative control (not illustrated). L, HCN2 binds to fascin-2 by yeast two-hybrid co-transformation. Row 1, HCN2 carboxyl terminus in bait vector pGBKT7 plus fascin-2 in prey vector pGADT7; row 2, negative control with fascin-2 in prey construct plus empty bait construct; row 3, negative control with HCN2 in bait construct plus empty prey construct. The co-transformation screening was performed once, and then the desired colony was re-plated onto another selection media in triplicate, with negative controls. The same concentrations of yeast were plated in the grids for rows 1-3. M, anti-fascin-2 immunoprecipitation of HCN2. Lane 1, standards; lane 2, 95 kDa (arrow) and 127-kDa bands, corresponding to unglycosylated and glycosylated HCN2, respectively; lane 3 negative control without anti-fascin 2 antibody in immunoprecipitation (brain lysate and beads). N, HCN1 is in fascin-2 immunoprecipitation complex along with HCN2. Lane 1, standards; lane 2, unglycosylated (arrow) and glycosylated forms of HCN1 at 120 kDa. Lane 3, goat IgG immunoprecipitation negative control, with beads and all components except anti-fascin-2 for immunoprecipitation. Three or more immunoprecipitation experiments were carried out for each protein in a given complex.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Immunoprecipitation by primary antibodies to filamin A, HCN2, and fascin-2. Immunoreactivity for filamin A detected by DAB (A) and immunofluorescence (B) (mouse MAB1678 raised to human filamin A crossing to rat; 1:1,000, clone PM6/317, Chemicon) was localized to stereocilia of both inner hair cells (long arrows) and outer hair cells (short arrows) in rat cochlea. Scale bars for A and B, 10 μm. C, lane 1, full-length filamin A (detected with filamin A primary antibody 1:1,000) in immunoprecipitation complex arising from the use of anti-filamin A for immunoprecipitation (1:100) from rat brain lysate. This antibody recognizes unprocessed filamin A (270–280 kDa, arrow, as well as 170-, 150-, and 120-kDa cleavage fragments (Chemicon)). Lane 2, negative control with brain lysate, without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, standards. D, additional negative control for C. Immunoprecipitation with mouse IgG as negative control probed with antifilamin A. Lane 1, mouse IgG immunoprecipitation of brain lysate + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 2, mouse IgG (no immunoprecipitation) + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 3, denatured mouse IgG electrophoresis, probed with filamin A primary + donkey anti-mouse secondary. No protein was observed corresponding to molecular mass of filamin A (arrow). E, Western blot of HCN1 (104 kDa, arrow) in rat brain lysate (1:50, sc-19706, Santa Cruz Biotechnology), lane 1; lane 2, standards. F, immunoprecipitation by anti-filamin A of full-length HCN1. Lane 1, standards; lane 2, negative control with brain lysate without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, HCN1 immunoprecipitated with anti-filamin A (arrow, 104 kDa), detected with goat anti-mouse HCN1 (carboxyl terminus) which crosses to rat HCN1 sequence (sc-19706 Santa Cruz Biotechnology). G, complex of filamin A and HCN1 also contained protocadherin 15 CD3. Lane 1, standards; lane 2, full-length protocadherin 15 CD3 (189 kDa, arrow) immunoprecipitated with anti-filamin A detected with custom primary antibody (1:10,000) (arrow). Goat anti-chick IgY-HRP (Santa Cruz Biotechnology) was used as the secondary antibody (1:10,000). Lane 3, negative control without anti-filamin A immunoprecipitation but with brain lysate and protein A beads and primary and secondary antibodies. H, Western blot of HCN2 in rat brain lysate. Lane 1, standards; lane 2, HCN2 detected with a rabbit polyclonal antibody (1:200, Alomone). Predicted molecular masses of 95 and 127 kDa corresponding to unglycosylated (arrow) and glycosylated HCN2, respectively. I, HCN2 is not detected in the complex immunoprecipitated by anti-filamin A. Lane 1, standards; lane 2, HCN2 bands observed in Western (H) are not detected in immunoprecipitated complex. Bands at 170–180 kDa may correspond to protocadherin 15 CD3, given that 5 of 15 aa in the epitope targeted by the HCN2 antibody are identical in protocadherin 15 CD3, and further given that protocadherin 15 CD3 is highly concentrated in the complex immunoprecipitated by anti-filamin A (G). J, anti-HCN2 immunoprecipitates HCN1 from rat brain lysate. Lane 1, standards; lane 2, anti-HCN2 primary antibody (1:33, Alomone) immunoprecipitates HCN1 unglycosylated (104 kDa, arrow) and glycosylated (120 and 130 kDa) forms detected with anti-HCN1 primary antibody (Santa Cruz Biotechnology); lane 3, negative control for immunoprecipitation with all components except anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). K, anti-HCN2 immunoprecipitation of HCN1 complex does not include protocadherin 15 CD3. Lane 1, standards; lane 2, anti-protocadherin 15 CD3 primary antibody (1:7,500), goat anti-chick secondary antibody (1:5,000); lane 3, negative control without anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). No bands were evident for either experimental (lane 2) or negative control (lane 3) with goat anti-chick IgY as the secondary antibody. In a second protocol, a bovine anti-chick secondary antibody (1:5,000) detected an ∼170-kDa protein in both experimental and negative control (not illustrated). L, HCN2 binds to fascin-2 by yeast two-hybrid co-transformation. Row 1, HCN2 carboxyl terminus in bait vector pGBKT7 plus fascin-2 in prey vector pGADT7; row 2, negative control with fascin-2 in prey construct plus empty bait construct; row 3, negative control with HCN2 in bait construct plus empty prey construct. The co-transformation screening was performed once, and then the desired colony was re-plated onto another selection media in triplicate, with negative controls. The same concentrations of yeast were plated in the grids for rows 1-3. M, anti-fascin-2 immunoprecipitation of HCN2. Lane 1, standards; lane 2, 95 kDa (arrow) and 127-kDa bands, corresponding to unglycosylated and glycosylated HCN2, respectively; lane 3 negative control without anti-fascin 2 antibody in immunoprecipitation (brain lysate and beads). N, HCN1 is in fascin-2 immunoprecipitation complex along with HCN2. Lane 1, standards; lane 2, unglycosylated (arrow) and glycosylated forms of HCN1 at 120 kDa. Lane 3, goat IgG immunoprecipitation negative control, with beads and all components except anti-fascin-2 for immunoprecipitation. Three or more immunoprecipitation experiments were carried out for each protein in a given complex.

Article Snippet: Primary antibodies included a rabbit polyclonal raised to rat HCN1 amino terminus, aa 6–24 (APC-056, Alomone; 1:25), and a rabbit polyclonal raised to amino acids 147–161 of human HCN2, identical to rat HCN2 sequence (APC-030, Alomone; 1:200).

Techniques: Immunoprecipitation, Immunofluorescence, Negative Control, Electrophoresis, Western Blot, Sequencing, Transformation Assay, Plasmid Preparation, Construct, Selection

a, Schematic representation of the AAV8 expression vector for in vivo targeting of SC. U6, Pol III promoter driving the expression of the gRNA targeting the Slc1a5 locus or a non-targeting control gRNA. Since the mice used in this experiment are LSL-Cas9 x PAX7:Cre-ERT mice, Cas9 is exclusively activated in Pax7 + cells upon tamoxifen administration and, genome editing of the Slc1a5 locus will occur selectively in SC. b, Schematic overview of an AAV8-based CRISPR/Cas9-mediated in vivo genome editing. c-d, Representative images ( c ) and quantification ( d ) for Pax7 and Cas9 staining on uninjured muscles before and after tamoxifen administration ( n =4). e-f , RT-qPCR for Slc1a5 in freshly isolated SC ( n =4) ( e ) and all other mononuclear cells (non-SC) ( n =3) ( f ) upon in vivo genome editing of the Slc1a5 locus (SLC1A5-KD) specific in SC. Non-targeting control gRNA (Ctrl gRNA) was used as a control. g-h, Quantification ( g ) and representative images ( h ) of SLC1A5 and Pax7 stainings on freshly isolated SC, upon in vivo genome editing of the Slc1a5 locus (SLC1A5-KD) specific in SC ( n =3). All experiments show representative values of at least 2 independent experiments. Unpaired two-tailed t -test was everywhere applied; ns, not significant ( P >0.05). Scale bars: 50 μm ( c ); 20 μm ( h ). Graphs show mean ± SEM.

Journal: Nature

Article Title: Macrophage-derived glutamine boosts satellite cells and muscle regeneration

doi: 10.1038/s41586-020-2857-9

Figure Lengend Snippet: a, Schematic representation of the AAV8 expression vector for in vivo targeting of SC. U6, Pol III promoter driving the expression of the gRNA targeting the Slc1a5 locus or a non-targeting control gRNA. Since the mice used in this experiment are LSL-Cas9 x PAX7:Cre-ERT mice, Cas9 is exclusively activated in Pax7 + cells upon tamoxifen administration and, genome editing of the Slc1a5 locus will occur selectively in SC. b, Schematic overview of an AAV8-based CRISPR/Cas9-mediated in vivo genome editing. c-d, Representative images ( c ) and quantification ( d ) for Pax7 and Cas9 staining on uninjured muscles before and after tamoxifen administration ( n =4). e-f , RT-qPCR for Slc1a5 in freshly isolated SC ( n =4) ( e ) and all other mononuclear cells (non-SC) ( n =3) ( f ) upon in vivo genome editing of the Slc1a5 locus (SLC1A5-KD) specific in SC. Non-targeting control gRNA (Ctrl gRNA) was used as a control. g-h, Quantification ( g ) and representative images ( h ) of SLC1A5 and Pax7 stainings on freshly isolated SC, upon in vivo genome editing of the Slc1a5 locus (SLC1A5-KD) specific in SC ( n =3). All experiments show representative values of at least 2 independent experiments. Unpaired two-tailed t -test was everywhere applied; ns, not significant ( P >0.05). Scale bars: 50 μm ( c ); 20 μm ( h ). Graphs show mean ± SEM.

Article Snippet: Samples were then probed with mouse anti-Pax7 (DSHB, 1:20) alone or incombination with rabbit anti-SLC1A5 (Alomone Labs, 1:50) for 2h at RT followed by incubation with mouse Alexa 568 (Invitrogen, 1:10000), or a combination of mouse Alexa 488 and rabbit 568 conjugated secondary antibodies (Invitrogen, 1:1000), respectively.

Techniques: Expressing, Plasmid Preparation, In Vivo, CRISPR, Staining, Quantitative RT-PCR, Isolation, Two Tailed Test

(A–H) Immunohistochemistry of MafA WT and Maf A RIP islets to show expression of CHRNA4 (A and B; green), CHRNA5 (C and D; green), CHRNB2 (E and F; green), and CHRNB4 (G and H; green). β cells are stained for insulin (red) and nuclei (DAPI; blue); scale bar represents 20 µm. (I) qPCR amplification of Chrn upstream sequences after immunoprecipitation of βTC-6 chromatin with a MAFA or rabbit IgG antibody are presented as % input. Differences in percent input for IgG reflect variations in primer efficiencies. n = 4. (J) Induction of luciferase reporter activity of ChrnB2 (pB2LUC) and ChrnB4 (pB4LUC) luciferase reporter constructs upon co-transfection with MAFA. Empty vector control (pGl2b and pFOX) is set to one; n = 3 or 4. (K) qPCR measurements of Chrn expression levels in MafA siRNA-treated βTC6 cells; n ≥ 3. Data were normalized to the geomean of HPRT and β- actin mRNA levels. (L) Dynamic insulin secretion of MafA WT and MafA RIP islets stimulated with 10 mM glucose (G) and 100 µM nicotine (NIC), 100 µM nicotine + 100 µM oxotremorine (NIC+OXO), and 100 µM oxotremorine (OXO). The transient decrease in insulin secretion upon NIC treatment in MafA WT islets is marked by a solid arrow. The biphasic insulin secretion induced by NIC+OXO treatment is indicated by a dashed arrow and a dotted arrow; n = 8. (M) Dynamic insulin secretion of wild-type islets with 1 or 10 µM acetylcholine (n ≥ 5). Acetylcholine treatment is illustrated by black lines. Data are mean ± SEM and were analyzed using one-way ANOVA and Tukey multiple comparison tests (J) or paired t test (I and K). *p < 0.05 and **p < 0.01. See for validation of the nicotinic receptor antibodies.

Journal: Cell reports

Article Title: MafA-Controlled Nicotinic Receptor Expression Is Essential for Insulin Secretion and Is Impaired in Patients with Type 2 Diabetes

doi: 10.1016/j.celrep.2016.02.002

Figure Lengend Snippet: (A–H) Immunohistochemistry of MafA WT and Maf A RIP islets to show expression of CHRNA4 (A and B; green), CHRNA5 (C and D; green), CHRNB2 (E and F; green), and CHRNB4 (G and H; green). β cells are stained for insulin (red) and nuclei (DAPI; blue); scale bar represents 20 µm. (I) qPCR amplification of Chrn upstream sequences after immunoprecipitation of βTC-6 chromatin with a MAFA or rabbit IgG antibody are presented as % input. Differences in percent input for IgG reflect variations in primer efficiencies. n = 4. (J) Induction of luciferase reporter activity of ChrnB2 (pB2LUC) and ChrnB4 (pB4LUC) luciferase reporter constructs upon co-transfection with MAFA. Empty vector control (pGl2b and pFOX) is set to one; n = 3 or 4. (K) qPCR measurements of Chrn expression levels in MafA siRNA-treated βTC6 cells; n ≥ 3. Data were normalized to the geomean of HPRT and β- actin mRNA levels. (L) Dynamic insulin secretion of MafA WT and MafA RIP islets stimulated with 10 mM glucose (G) and 100 µM nicotine (NIC), 100 µM nicotine + 100 µM oxotremorine (NIC+OXO), and 100 µM oxotremorine (OXO). The transient decrease in insulin secretion upon NIC treatment in MafA WT islets is marked by a solid arrow. The biphasic insulin secretion induced by NIC+OXO treatment is indicated by a dashed arrow and a dotted arrow; n = 8. (M) Dynamic insulin secretion of wild-type islets with 1 or 10 µM acetylcholine (n ≥ 5). Acetylcholine treatment is illustrated by black lines. Data are mean ± SEM and were analyzed using one-way ANOVA and Tukey multiple comparison tests (J) or paired t test (I and K). *p < 0.05 and **p < 0.01. See for validation of the nicotinic receptor antibodies.

Article Snippet: Primary antibodies were α-CHRNB2 antibody (1:200; no. ANC-012; Alomone Labs), α-ADRA2A antibody (1:500; no. A271; Sigma-Aldrich), α-CHRNA5 antibody (1:400; no. NBP1–69122; Novus Biologicals), α-CHRNA4 antibody (1:500; no. ANC-004; Alomone Labs), α-CHRNB4 antibody (1:500; no. ANC-014; Alomone Labs), and monoclonal mouse α-pactin antibody (1:2,000; Sigma).

Techniques: Immunohistochemistry, Expressing, Staining, Amplification, Immunoprecipitation, Luciferase, Activity Assay, Construct, Cotransfection, Plasmid Preparation

(A) Regional plot of the CHRNB4 gene showing the presence of a cluster of SNPs that infer low expression of CHRNB4 in human islets. The leading SNP (rs12910237) is indicated in purple. (B) Effect of alternate rs12910237 allele copy numbers on CHRNB4 transcript levels in islets from human donors; n = 89 (p = 1.98E–05). (C) Overview of the CHRNB4 upstream region containing SNPs affecting islet gene transcription and the risk for developing type 2 diabetes. MAF and other transcription-factor-binding sites and active islet enhancer regions are shown . Transcriptional activity in the β cell line β-TC6 and activation by MafA is indicated. (D–G) Analysis of RNA-seq data from human donor islets to show the correlation between CHRNB2 expression and MAFA and MAFB transcript levels, insulin secretion (stimulatory index), and HbA1c levels. (H–K) Analysis of RNA-seq data from human donor islets to show the correlation between CHRNB4, MAFA , and MAFB ; stimulatory index; and HbA1c levels. Experiments were analyzed with linear regression and Pearson correlation analysis; p values are indicated in the respective graphs; n = 131. (L) siRNA-mediated knockdown of MAFA in EndoC-βH1 cells, showing the effect on mRNA levels of CHRNB2 (p = 0.04), CHRNB4 (p = 0.05), and ADRA2A (p = 0.055); n = 3 or 4. (M) Effect of pCMVMafA (MafA) expression on luciferase (Luc) activities of human CHRNB4 upstream reporter constructs (p-3.7kbLUC and p-7.5kbLUC) spanning sequences that contain identified risk(R) and corresponding non-risk alleles (NR) for rs12910237 or rs922691 and islet enhancer regions. Activity was assessed in HEK293 cells, which do not have endogenous MAFA activity. n = 4. Data are mean ± SEM and were analyzed using one-way ANOVA and Tukey multiple comparison tests (M) and Student’s t test (L). *p < 0.05; **p < 0.01; ****p < 0.001. Abbreviations: T2D, type 2 diabetes; TF, transcription factor. See also for additional correlation and transcriptional data.

Journal: Cell reports

Article Title: MafA-Controlled Nicotinic Receptor Expression Is Essential for Insulin Secretion and Is Impaired in Patients with Type 2 Diabetes

doi: 10.1016/j.celrep.2016.02.002

Figure Lengend Snippet: (A) Regional plot of the CHRNB4 gene showing the presence of a cluster of SNPs that infer low expression of CHRNB4 in human islets. The leading SNP (rs12910237) is indicated in purple. (B) Effect of alternate rs12910237 allele copy numbers on CHRNB4 transcript levels in islets from human donors; n = 89 (p = 1.98E–05). (C) Overview of the CHRNB4 upstream region containing SNPs affecting islet gene transcription and the risk for developing type 2 diabetes. MAF and other transcription-factor-binding sites and active islet enhancer regions are shown . Transcriptional activity in the β cell line β-TC6 and activation by MafA is indicated. (D–G) Analysis of RNA-seq data from human donor islets to show the correlation between CHRNB2 expression and MAFA and MAFB transcript levels, insulin secretion (stimulatory index), and HbA1c levels. (H–K) Analysis of RNA-seq data from human donor islets to show the correlation between CHRNB4, MAFA , and MAFB ; stimulatory index; and HbA1c levels. Experiments were analyzed with linear regression and Pearson correlation analysis; p values are indicated in the respective graphs; n = 131. (L) siRNA-mediated knockdown of MAFA in EndoC-βH1 cells, showing the effect on mRNA levels of CHRNB2 (p = 0.04), CHRNB4 (p = 0.05), and ADRA2A (p = 0.055); n = 3 or 4. (M) Effect of pCMVMafA (MafA) expression on luciferase (Luc) activities of human CHRNB4 upstream reporter constructs (p-3.7kbLUC and p-7.5kbLUC) spanning sequences that contain identified risk(R) and corresponding non-risk alleles (NR) for rs12910237 or rs922691 and islet enhancer regions. Activity was assessed in HEK293 cells, which do not have endogenous MAFA activity. n = 4. Data are mean ± SEM and were analyzed using one-way ANOVA and Tukey multiple comparison tests (M) and Student’s t test (L). *p < 0.05; **p < 0.01; ****p < 0.001. Abbreviations: T2D, type 2 diabetes; TF, transcription factor. See also for additional correlation and transcriptional data.

Article Snippet: Primary antibodies were α-CHRNB2 antibody (1:200; no. ANC-012; Alomone Labs), α-ADRA2A antibody (1:500; no. A271; Sigma-Aldrich), α-CHRNA5 antibody (1:400; no. NBP1–69122; Novus Biologicals), α-CHRNA4 antibody (1:500; no. ANC-004; Alomone Labs), α-CHRNB4 antibody (1:500; no. ANC-014; Alomone Labs), and monoclonal mouse α-pactin antibody (1:2,000; Sigma).

Techniques: Expressing, Binding Assay, Activity Assay, Activation Assay, RNA Sequencing Assay, Luciferase, Construct

SNPs Upstream of the  CHRNB4  Gene Are Associated with  CHRNB4  Gene Expression in Islets from Human Donors

Journal: Cell reports

Article Title: MafA-Controlled Nicotinic Receptor Expression Is Essential for Insulin Secretion and Is Impaired in Patients with Type 2 Diabetes

doi: 10.1016/j.celrep.2016.02.002

Figure Lengend Snippet: SNPs Upstream of the CHRNB4 Gene Are Associated with CHRNB4 Gene Expression in Islets from Human Donors

Article Snippet: Primary antibodies were α-CHRNB2 antibody (1:200; no. ANC-012; Alomone Labs), α-ADRA2A antibody (1:500; no. A271; Sigma-Aldrich), α-CHRNA5 antibody (1:400; no. NBP1–69122; Novus Biologicals), α-CHRNA4 antibody (1:500; no. ANC-004; Alomone Labs), α-CHRNB4 antibody (1:500; no. ANC-014; Alomone Labs), and monoclonal mouse α-pactin antibody (1:2,000; Sigma).

Techniques: Expressing, Significance Assay

Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for HCN1-specific (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Molecular requirements for HCN amino terminus binding to protocadherin 15 CD3 determined with SPR for rat organ of Corti proteins. A, SPR for HCN1-specific (nonconserved) amino terminus sequence as follows: protocadherin 15 CD3 as ligand, HCN1-specific (nonconserved) amino terminus as analyte at 100 nm; 100 μm Ca2+ (light green), 1 mm EGTA (turquoise); buffer control (100 μm Ca2+, black). B, HCN1-specific amino terminus as analyte at 100 nm; 100 μm Ca2+ (pink, black, and turquoise, three repeats); buffer control (red). C, HCN1 full-length amino terminus as analyte at 100 nm; 100 μm Ca2+ (green), 26.5 μm Ca2+ (black), 1 mm EGTA (turquoise). D, conserved HCN1 amino-terminal sequence as analyte at 200 nm; 100 μm Ca2+. E, HCN2-specific amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific amino terminus at 100 nm, 100 μm Ca2+ (green). There is no binding of the HCN2-specific amino-terminal sequence to protocadherin 15 CD3. F, HCN4-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (red); HCN1-specific (nonconserved) amino terminus as analyte at 100 nm, 100 μm Ca2+ (blue). There is no binding of HCN4 to protocadherin 15 CD3. A–F, three SPR determinations were performed for each condition/construct. (For KD values, see Table 1.) RU, response units.

Article Snippet: After centrifugation at 20,900 × g for 5 min at 4 °C to remove the beads (and nonspecific binding proteins), the supernatant was utilized for immunoprecipitation overnight (4 °C) with mouse anti-human filamin A (clone PM6/317, MAB1678, Chemicon), which crosses to rat sequence, rabbit anti-human HCN2 (targeting aa 147–161, UniProtKB/Swiss Prot {"type":"entrez-protein","attrs":{"text":"Q9UL51","term_id":"108935843","term_text":"Q9UL51"}} Q9UL51 , identical to rat HCN2 sequence, APC-030, Alomone), or goat anti-fascin-2 (EB08002, Everest Biotech, UK).

Techniques: Binding Assay, Sequencing, Construct

Amplification of HCN1 and HCN2 cDNA from cochlear inner and outer hair cells. A, agarose gel for HCN1 PCR indicating amplification from the cochlear inner and outer hair cell cDNA of predicted 397-bp product crossing intron (white arrows). Nucleotide sequencing of uncloned rat HCN1 amplification product from cochlear IHC indicated 100% identity to rat HCN1. Nested primers applied in PCR to the OHC 397-bp product elicited amplification of HCN1 cDNA with 100% identity to rat HCN1 nucleotide sequence. The adjacent lanes (IHC and OHC) with a second set of primers for HCN1 yielded negative results. B, agarose gel for amplification of HCN2 cDNA from rat cochlear outer hair cells (209 bp, crossing intron, black arrow) with 100% nucleotide identity to rat HCN2. S, 1-kb standards; B, water blanks.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Amplification of HCN1 and HCN2 cDNA from cochlear inner and outer hair cells. A, agarose gel for HCN1 PCR indicating amplification from the cochlear inner and outer hair cell cDNA of predicted 397-bp product crossing intron (white arrows). Nucleotide sequencing of uncloned rat HCN1 amplification product from cochlear IHC indicated 100% identity to rat HCN1. Nested primers applied in PCR to the OHC 397-bp product elicited amplification of HCN1 cDNA with 100% identity to rat HCN1 nucleotide sequence. The adjacent lanes (IHC and OHC) with a second set of primers for HCN1 yielded negative results. B, agarose gel for amplification of HCN2 cDNA from rat cochlear outer hair cells (209 bp, crossing intron, black arrow) with 100% nucleotide identity to rat HCN2. S, 1-kb standards; B, water blanks.

Article Snippet: After centrifugation at 20,900 × g for 5 min at 4 °C to remove the beads (and nonspecific binding proteins), the supernatant was utilized for immunoprecipitation overnight (4 °C) with mouse anti-human filamin A (clone PM6/317, MAB1678, Chemicon), which crosses to rat sequence, rabbit anti-human HCN2 (targeting aa 147–161, UniProtKB/Swiss Prot {"type":"entrez-protein","attrs":{"text":"Q9UL51","term_id":"108935843","term_text":"Q9UL51"}} Q9UL51 , identical to rat HCN2 sequence, APC-030, Alomone), or goat anti-fascin-2 (EB08002, Everest Biotech, UK).

Techniques: Amplification, Agarose Gel Electrophoresis, Sequencing

z-Stack confocal immunofluorescence analysis of HCN1 and HCN2 protein expression in the organ of Corti of the adult mouse. A and B, three-dimensional reconstruction of 43 1-μm confocal optical slices, indicating immunofluorescence (red) for HCN1 (Abcam 1:50) and HCN2 (green) (Alomone, 1:200) in the organ of Corti of the adult mouse. Immunofluorescence for HCN1 was localized to stereociliary arrays for outer hair cells, which in the reconstruction extended to subcuticular sites (A, short arrow). Immunofluorescence (red) for inner hair cell stereociliary regions was visible but more sparse (A, arrowhead). HCN2 immunoreactivity (green) co-localized with HCN1 in afferents beneath the inner hair cells (A and B, yellow, long arrows). Afferents beneath outer hair cells contained primarily immunofluorescence for HCN1 (A and B, red, medium arrows). The situation that was set up was potentially one of possible competition between HCN1 and HCN2 primary antibodies. Regions of intense immunoreactivity for HCN2 appeared adjacent to the outer hair cells, consistent in position to extensions of Deiters' cells (A, short arrow with dot). Scale bars for A and B, 20 μm. B, second position of three-dimensional reconstruction of z-stack confocal optical slices. The results were consistent with differential distribution of HCN1 and HCN2 in cells of the organ of Corti and differential expression at intracellular sites. C, 1-μm optical section 3 μm in from beginning position of the z-stack, illustrating HCN1 immunofluorescence (red, Santa Cruz Biotechnology) in cochlear outer hair cell stereociliary arrays, with arrows pointing to two individual inner rows of stereocilia in the stereociliary array. Scale bars for C–E, 4 μm. D, 1-μm optical section (paired with C), showing HCN2 immunofluorescence (green, Alomone) in OHC stereocilia (arrow). E, confocally determined overlap (yellow) of HCN1 (C) with HCN2 (D) in stereocilia of OHC (arrow). F, z-stack confocal imaging of HCN2 immunofluorescence (green) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow), 0.3-μm optical section (0.6 μm into z-stack) for HCN2 and phalloidin combination. Scale bars for F–H, 20 μm. G, rhodamine-coupled phalloidin detection of F-actin (red) in cochlear hair cell stereocilia. H, confocal overlap of HCN2 with phalloidin (yellow) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow). I, magnified view of HCN2 overlap with phalloidin in IHC stereocilia (arrow). Scale bar, 10 μm.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: z-Stack confocal immunofluorescence analysis of HCN1 and HCN2 protein expression in the organ of Corti of the adult mouse. A and B, three-dimensional reconstruction of 43 1-μm confocal optical slices, indicating immunofluorescence (red) for HCN1 (Abcam 1:50) and HCN2 (green) (Alomone, 1:200) in the organ of Corti of the adult mouse. Immunofluorescence for HCN1 was localized to stereociliary arrays for outer hair cells, which in the reconstruction extended to subcuticular sites (A, short arrow). Immunofluorescence (red) for inner hair cell stereociliary regions was visible but more sparse (A, arrowhead). HCN2 immunoreactivity (green) co-localized with HCN1 in afferents beneath the inner hair cells (A and B, yellow, long arrows). Afferents beneath outer hair cells contained primarily immunofluorescence for HCN1 (A and B, red, medium arrows). The situation that was set up was potentially one of possible competition between HCN1 and HCN2 primary antibodies. Regions of intense immunoreactivity for HCN2 appeared adjacent to the outer hair cells, consistent in position to extensions of Deiters' cells (A, short arrow with dot). Scale bars for A and B, 20 μm. B, second position of three-dimensional reconstruction of z-stack confocal optical slices. The results were consistent with differential distribution of HCN1 and HCN2 in cells of the organ of Corti and differential expression at intracellular sites. C, 1-μm optical section 3 μm in from beginning position of the z-stack, illustrating HCN1 immunofluorescence (red, Santa Cruz Biotechnology) in cochlear outer hair cell stereociliary arrays, with arrows pointing to two individual inner rows of stereocilia in the stereociliary array. Scale bars for C–E, 4 μm. D, 1-μm optical section (paired with C), showing HCN2 immunofluorescence (green, Alomone) in OHC stereocilia (arrow). E, confocally determined overlap (yellow) of HCN1 (C) with HCN2 (D) in stereocilia of OHC (arrow). F, z-stack confocal imaging of HCN2 immunofluorescence (green) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow), 0.3-μm optical section (0.6 μm into z-stack) for HCN2 and phalloidin combination. Scale bars for F–H, 20 μm. G, rhodamine-coupled phalloidin detection of F-actin (red) in cochlear hair cell stereocilia. H, confocal overlap of HCN2 with phalloidin (yellow) in cochlear outer hair cell stereocilia (short arrows) and inner hair cell stereocilia (medium arrow). I, magnified view of HCN2 overlap with phalloidin in IHC stereocilia (arrow). Scale bar, 10 μm.

Article Snippet: After centrifugation at 20,900 × g for 5 min at 4 °C to remove the beads (and nonspecific binding proteins), the supernatant was utilized for immunoprecipitation overnight (4 °C) with mouse anti-human filamin A (clone PM6/317, MAB1678, Chemicon), which crosses to rat sequence, rabbit anti-human HCN2 (targeting aa 147–161, UniProtKB/Swiss Prot {"type":"entrez-protein","attrs":{"text":"Q9UL51","term_id":"108935843","term_text":"Q9UL51"}} Q9UL51 , identical to rat HCN2 sequence, APC-030, Alomone), or goat anti-fascin-2 (EB08002, Everest Biotech, UK).

Techniques: Immunofluorescence, Expressing, Imaging

Pre-embedding immunogold detection of HCN1 and HCN2 in hair cells of the organ of Corti in the adult rat. A and B, HCN1 immunogold (Alomone antibody) is found at apical and lateral sites on stereocilia of outer hair cells (arrows) (magnified in A1) not dissimilar in position to that reported for tip-link proteins (4). Also note that HCN1 immunogold in A is concentrated at subcuticular plate sites (short arrows) of outer hair cells (magnified in A2). Scale bars, 500 nm for A; 250 nm for A1 and A2; 100 nm for B. C, HCN1 immunogold (arrows, Alomone primary antibody) is localized in IHC to filaments extending at lateral positions, possibly cross-connecting stereocilia. Scale bar, 300 nm. Magnified view is shown in supplemental Fig. 3A. D, HCN1 immunogold (arrows, Alomone primary antibody) was found in type II afferent endings (A) on OHC (H), as was observed with confocal immunofluorescence with a different HCN1 antibody (Abcam) and different rodent (mouse). Scale bar, 200 nm. Magnified view is shown in supplemental Fig. 3B; HCN2 immunogold was found at lateral positions on taller stereocilia of OHC in the adult rat (E, arrows; magnified in E1) as well as at sites at the top of shorter stereocilia (F–I, arrows). As with HCN1, immunogold for HCN2 was also found at sites beneath the cuticular plate (E, short arrows, magnified in E2), but unlike HCN1, HCN2 was not found in type II afferent dendrites at the base of OHC (not illustrated), consistent with results from confocal microscopy. Scales bars, 500 nm for E; 250 nm for E1; 100 nm for E2, and F–I.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Pre-embedding immunogold detection of HCN1 and HCN2 in hair cells of the organ of Corti in the adult rat. A and B, HCN1 immunogold (Alomone antibody) is found at apical and lateral sites on stereocilia of outer hair cells (arrows) (magnified in A1) not dissimilar in position to that reported for tip-link proteins (4). Also note that HCN1 immunogold in A is concentrated at subcuticular plate sites (short arrows) of outer hair cells (magnified in A2). Scale bars, 500 nm for A; 250 nm for A1 and A2; 100 nm for B. C, HCN1 immunogold (arrows, Alomone primary antibody) is localized in IHC to filaments extending at lateral positions, possibly cross-connecting stereocilia. Scale bar, 300 nm. Magnified view is shown in supplemental Fig. 3A. D, HCN1 immunogold (arrows, Alomone primary antibody) was found in type II afferent endings (A) on OHC (H), as was observed with confocal immunofluorescence with a different HCN1 antibody (Abcam) and different rodent (mouse). Scale bar, 200 nm. Magnified view is shown in supplemental Fig. 3B; HCN2 immunogold was found at lateral positions on taller stereocilia of OHC in the adult rat (E, arrows; magnified in E1) as well as at sites at the top of shorter stereocilia (F–I, arrows). As with HCN1, immunogold for HCN2 was also found at sites beneath the cuticular plate (E, short arrows, magnified in E2), but unlike HCN1, HCN2 was not found in type II afferent dendrites at the base of OHC (not illustrated), consistent with results from confocal microscopy. Scales bars, 500 nm for E; 250 nm for E1; 100 nm for E2, and F–I.

Article Snippet: After centrifugation at 20,900 × g for 5 min at 4 °C to remove the beads (and nonspecific binding proteins), the supernatant was utilized for immunoprecipitation overnight (4 °C) with mouse anti-human filamin A (clone PM6/317, MAB1678, Chemicon), which crosses to rat sequence, rabbit anti-human HCN2 (targeting aa 147–161, UniProtKB/Swiss Prot {"type":"entrez-protein","attrs":{"text":"Q9UL51","term_id":"108935843","term_text":"Q9UL51"}} Q9UL51 , identical to rat HCN2 sequence, APC-030, Alomone), or goat anti-fascin-2 (EB08002, Everest Biotech, UK).

Techniques: Immunofluorescence, Confocal Microscopy

Quantitative PCR analysis of HCN isoform expression in organ of Corti of adult mouse for wild type and HCN1−/−. A, agarose gel resolution of PCR product for full-length HCN1 cDNA in organ of Corti for control (lane 2, predicted Δ = 2,363 bp) versus mutant (lane 3, predicted Δ = 2,144 bp), demonstrating full-length sequence in mutant with the in-frame deletion. B, nucleotide sequence for organ of Corti HCN1 in the HCN1−/−, demonstrating again, as for brain, contiguous mRNA sequence before and after the in-frame deletion of the pore filter and sixth trans-membrane region. Arrow shows splice location between exons 3 and 5 (exon 4 is deleted in the mutant). C, quantitative PCR for HCN isoforms in morphologically defined mouse cochlear organ of Corti subfraction (6) for HCN1−/− versus control. *** indicates p = 0.0026 for HCN1 in HCN1 mutant versus control ΔCt by unpaired, two-tailed t test. * indicates p = 0.054 for HCN2 in HCN1 mutant versus control. Five sets of experiments each with two replicates per point.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Quantitative PCR analysis of HCN isoform expression in organ of Corti of adult mouse for wild type and HCN1−/−. A, agarose gel resolution of PCR product for full-length HCN1 cDNA in organ of Corti for control (lane 2, predicted Δ = 2,363 bp) versus mutant (lane 3, predicted Δ = 2,144 bp), demonstrating full-length sequence in mutant with the in-frame deletion. B, nucleotide sequence for organ of Corti HCN1 in the HCN1−/−, demonstrating again, as for brain, contiguous mRNA sequence before and after the in-frame deletion of the pore filter and sixth trans-membrane region. Arrow shows splice location between exons 3 and 5 (exon 4 is deleted in the mutant). C, quantitative PCR for HCN isoforms in morphologically defined mouse cochlear organ of Corti subfraction (6) for HCN1−/− versus control. *** indicates p = 0.0026 for HCN1 in HCN1 mutant versus control ΔCt by unpaired, two-tailed t test. * indicates p = 0.054 for HCN2 in HCN1 mutant versus control. Five sets of experiments each with two replicates per point.

Article Snippet: After centrifugation at 20,900 × g for 5 min at 4 °C to remove the beads (and nonspecific binding proteins), the supernatant was utilized for immunoprecipitation overnight (4 °C) with mouse anti-human filamin A (clone PM6/317, MAB1678, Chemicon), which crosses to rat sequence, rabbit anti-human HCN2 (targeting aa 147–161, UniProtKB/Swiss Prot {"type":"entrez-protein","attrs":{"text":"Q9UL51","term_id":"108935843","term_text":"Q9UL51"}} Q9UL51 , identical to rat HCN2 sequence, APC-030, Alomone), or goat anti-fascin-2 (EB08002, Everest Biotech, UK).

Techniques: Real-time Polymerase Chain Reaction, Expressing, Agarose Gel Electrophoresis, Mutagenesis, Sequencing, Two Tailed Test

Immunoprecipitation by primary antibodies to filamin A, HCN2, and fascin-2. Immunoreactivity for filamin A detected by DAB (A) and immunofluorescence (B) (mouse MAB1678 raised to human filamin A crossing to rat; 1:1,000, clone PM6/317, Chemicon) was localized to stereocilia of both inner hair cells (long arrows) and outer hair cells (short arrows) in rat cochlea. Scale bars for A and B, 10 μm. C, lane 1, full-length filamin A (detected with filamin A primary antibody 1:1,000) in immunoprecipitation complex arising from the use of anti-filamin A for immunoprecipitation (1:100) from rat brain lysate. This antibody recognizes unprocessed filamin A (270–280 kDa, arrow, as well as 170-, 150-, and 120-kDa cleavage fragments (Chemicon)). Lane 2, negative control with brain lysate, without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, standards. D, additional negative control for C. Immunoprecipitation with mouse IgG as negative control probed with antifilamin A. Lane 1, mouse IgG immunoprecipitation of brain lysate + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 2, mouse IgG (no immunoprecipitation) + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 3, denatured mouse IgG electrophoresis, probed with filamin A primary + donkey anti-mouse secondary. No protein was observed corresponding to molecular mass of filamin A (arrow). E, Western blot of HCN1 (104 kDa, arrow) in rat brain lysate (1:50, sc-19706, Santa Cruz Biotechnology), lane 1; lane 2, standards. F, immunoprecipitation by anti-filamin A of full-length HCN1. Lane 1, standards; lane 2, negative control with brain lysate without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, HCN1 immunoprecipitated with anti-filamin A (arrow, 104 kDa), detected with goat anti-mouse HCN1 (carboxyl terminus) which crosses to rat HCN1 sequence (sc-19706 Santa Cruz Biotechnology). G, complex of filamin A and HCN1 also contained protocadherin 15 CD3. Lane 1, standards; lane 2, full-length protocadherin 15 CD3 (189 kDa, arrow) immunoprecipitated with anti-filamin A detected with custom primary antibody (1:10,000) (arrow). Goat anti-chick IgY-HRP (Santa Cruz Biotechnology) was used as the secondary antibody (1:10,000). Lane 3, negative control without anti-filamin A immunoprecipitation but with brain lysate and protein A beads and primary and secondary antibodies. H, Western blot of HCN2 in rat brain lysate. Lane 1, standards; lane 2, HCN2 detected with a rabbit polyclonal antibody (1:200, Alomone). Predicted molecular masses of 95 and 127 kDa corresponding to unglycosylated (arrow) and glycosylated HCN2, respectively. I, HCN2 is not detected in the complex immunoprecipitated by anti-filamin A. Lane 1, standards; lane 2, HCN2 bands observed in Western (H) are not detected in immunoprecipitated complex. Bands at 170–180 kDa may correspond to protocadherin 15 CD3, given that 5 of 15 aa in the epitope targeted by the HCN2 antibody are identical in protocadherin 15 CD3, and further given that protocadherin 15 CD3 is highly concentrated in the complex immunoprecipitated by anti-filamin A (G). J, anti-HCN2 immunoprecipitates HCN1 from rat brain lysate. Lane 1, standards; lane 2, anti-HCN2 primary antibody (1:33, Alomone) immunoprecipitates HCN1 unglycosylated (104 kDa, arrow) and glycosylated (120 and 130 kDa) forms detected with anti-HCN1 primary antibody (Santa Cruz Biotechnology); lane 3, negative control for immunoprecipitation with all components except anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). K, anti-HCN2 immunoprecipitation of HCN1 complex does not include protocadherin 15 CD3. Lane 1, standards; lane 2, anti-protocadherin 15 CD3 primary antibody (1:7,500), goat anti-chick secondary antibody (1:5,000); lane 3, negative control without anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). No bands were evident for either experimental (lane 2) or negative control (lane 3) with goat anti-chick IgY as the secondary antibody. In a second protocol, a bovine anti-chick secondary antibody (1:5,000) detected an ∼170-kDa protein in both experimental and negative control (not illustrated). L, HCN2 binds to fascin-2 by yeast two-hybrid co-transformation. Row 1, HCN2 carboxyl terminus in bait vector pGBKT7 plus fascin-2 in prey vector pGADT7; row 2, negative control with fascin-2 in prey construct plus empty bait construct; row 3, negative control with HCN2 in bait construct plus empty prey construct. The co-transformation screening was performed once, and then the desired colony was re-plated onto another selection media in triplicate, with negative controls. The same concentrations of yeast were plated in the grids for rows 1-3. M, anti-fascin-2 immunoprecipitation of HCN2. Lane 1, standards; lane 2, 95 kDa (arrow) and 127-kDa bands, corresponding to unglycosylated and glycosylated HCN2, respectively; lane 3 negative control without anti-fascin 2 antibody in immunoprecipitation (brain lysate and beads). N, HCN1 is in fascin-2 immunoprecipitation complex along with HCN2. Lane 1, standards; lane 2, unglycosylated (arrow) and glycosylated forms of HCN1 at 120 kDa. Lane 3, goat IgG immunoprecipitation negative control, with beads and all components except anti-fascin-2 for immunoprecipitation. Three or more immunoprecipitation experiments were carried out for each protein in a given complex.

Journal: The Journal of Biological Chemistry

Article Title: HCN1 and HCN2 Proteins Are Expressed in Cochlear Hair Cells

doi: 10.1074/jbc.M112.375832

Figure Lengend Snippet: Immunoprecipitation by primary antibodies to filamin A, HCN2, and fascin-2. Immunoreactivity for filamin A detected by DAB (A) and immunofluorescence (B) (mouse MAB1678 raised to human filamin A crossing to rat; 1:1,000, clone PM6/317, Chemicon) was localized to stereocilia of both inner hair cells (long arrows) and outer hair cells (short arrows) in rat cochlea. Scale bars for A and B, 10 μm. C, lane 1, full-length filamin A (detected with filamin A primary antibody 1:1,000) in immunoprecipitation complex arising from the use of anti-filamin A for immunoprecipitation (1:100) from rat brain lysate. This antibody recognizes unprocessed filamin A (270–280 kDa, arrow, as well as 170-, 150-, and 120-kDa cleavage fragments (Chemicon)). Lane 2, negative control with brain lysate, without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, standards. D, additional negative control for C. Immunoprecipitation with mouse IgG as negative control probed with antifilamin A. Lane 1, mouse IgG immunoprecipitation of brain lysate + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 2, mouse IgG (no immunoprecipitation) + beads, probed with filamin A primary + donkey anti-mouse secondary. Lane 3, denatured mouse IgG electrophoresis, probed with filamin A primary + donkey anti-mouse secondary. No protein was observed corresponding to molecular mass of filamin A (arrow). E, Western blot of HCN1 (104 kDa, arrow) in rat brain lysate (1:50, sc-19706, Santa Cruz Biotechnology), lane 1; lane 2, standards. F, immunoprecipitation by anti-filamin A of full-length HCN1. Lane 1, standards; lane 2, negative control with brain lysate without anti-filamin A immunoprecipitation + beads + primary and secondary antibodies; lane 3, HCN1 immunoprecipitated with anti-filamin A (arrow, 104 kDa), detected with goat anti-mouse HCN1 (carboxyl terminus) which crosses to rat HCN1 sequence (sc-19706 Santa Cruz Biotechnology). G, complex of filamin A and HCN1 also contained protocadherin 15 CD3. Lane 1, standards; lane 2, full-length protocadherin 15 CD3 (189 kDa, arrow) immunoprecipitated with anti-filamin A detected with custom primary antibody (1:10,000) (arrow). Goat anti-chick IgY-HRP (Santa Cruz Biotechnology) was used as the secondary antibody (1:10,000). Lane 3, negative control without anti-filamin A immunoprecipitation but with brain lysate and protein A beads and primary and secondary antibodies. H, Western blot of HCN2 in rat brain lysate. Lane 1, standards; lane 2, HCN2 detected with a rabbit polyclonal antibody (1:200, Alomone). Predicted molecular masses of 95 and 127 kDa corresponding to unglycosylated (arrow) and glycosylated HCN2, respectively. I, HCN2 is not detected in the complex immunoprecipitated by anti-filamin A. Lane 1, standards; lane 2, HCN2 bands observed in Western (H) are not detected in immunoprecipitated complex. Bands at 170–180 kDa may correspond to protocadherin 15 CD3, given that 5 of 15 aa in the epitope targeted by the HCN2 antibody are identical in protocadherin 15 CD3, and further given that protocadherin 15 CD3 is highly concentrated in the complex immunoprecipitated by anti-filamin A (G). J, anti-HCN2 immunoprecipitates HCN1 from rat brain lysate. Lane 1, standards; lane 2, anti-HCN2 primary antibody (1:33, Alomone) immunoprecipitates HCN1 unglycosylated (104 kDa, arrow) and glycosylated (120 and 130 kDa) forms detected with anti-HCN1 primary antibody (Santa Cruz Biotechnology); lane 3, negative control for immunoprecipitation with all components except anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). K, anti-HCN2 immunoprecipitation of HCN1 complex does not include protocadherin 15 CD3. Lane 1, standards; lane 2, anti-protocadherin 15 CD3 primary antibody (1:7,500), goat anti-chick secondary antibody (1:5,000); lane 3, negative control without anti-HCN2 antibody for immunoprecipitation (brain lysate and beads). No bands were evident for either experimental (lane 2) or negative control (lane 3) with goat anti-chick IgY as the secondary antibody. In a second protocol, a bovine anti-chick secondary antibody (1:5,000) detected an ∼170-kDa protein in both experimental and negative control (not illustrated). L, HCN2 binds to fascin-2 by yeast two-hybrid co-transformation. Row 1, HCN2 carboxyl terminus in bait vector pGBKT7 plus fascin-2 in prey vector pGADT7; row 2, negative control with fascin-2 in prey construct plus empty bait construct; row 3, negative control with HCN2 in bait construct plus empty prey construct. The co-transformation screening was performed once, and then the desired colony was re-plated onto another selection media in triplicate, with negative controls. The same concentrations of yeast were plated in the grids for rows 1-3. M, anti-fascin-2 immunoprecipitation of HCN2. Lane 1, standards; lane 2, 95 kDa (arrow) and 127-kDa bands, corresponding to unglycosylated and glycosylated HCN2, respectively; lane 3 negative control without anti-fascin 2 antibody in immunoprecipitation (brain lysate and beads). N, HCN1 is in fascin-2 immunoprecipitation complex along with HCN2. Lane 1, standards; lane 2, unglycosylated (arrow) and glycosylated forms of HCN1 at 120 kDa. Lane 3, goat IgG immunoprecipitation negative control, with beads and all components except anti-fascin-2 for immunoprecipitation. Three or more immunoprecipitation experiments were carried out for each protein in a given complex.

Article Snippet: After centrifugation at 20,900 × g for 5 min at 4 °C to remove the beads (and nonspecific binding proteins), the supernatant was utilized for immunoprecipitation overnight (4 °C) with mouse anti-human filamin A (clone PM6/317, MAB1678, Chemicon), which crosses to rat sequence, rabbit anti-human HCN2 (targeting aa 147–161, UniProtKB/Swiss Prot {"type":"entrez-protein","attrs":{"text":"Q9UL51","term_id":"108935843","term_text":"Q9UL51"}} Q9UL51 , identical to rat HCN2 sequence, APC-030, Alomone), or goat anti-fascin-2 (EB08002, Everest Biotech, UK).

Techniques: Immunoprecipitation, Immunofluorescence, Negative Control, Electrophoresis, Western Blot, Sequencing, Transformation Assay, Plasmid Preparation, Construct, Selection

P2Y1 and P2X4 receptors activate mitochondria in response to TCR/CD28 stimulation. a Jurkat cells expressing the mitochondrial Ca2+ indicator mito-CAR-GECO1 were pretreated for 10 min with specific antagonists of P2X4 (5-BDBD, 10 μM) or P2Y1 (MRS2279, 10 μM) receptors or with the general P2 receptor antagonist suramin (100 μM). Then, cells were stimulated by TCR/CD28 cross-linking, and changes in mitochondrial Ca2+ uptake were recorded over time using fluorescence microscopy. Traces of individual cells are shown in gray, and the averages of all cells acquired (n = 30–80) are shown in red. Data shown are representative of independent experiments (n ≥ 3). b Averaged mean fluorescence values (+ SEM) of cells (n = 30-80) from different experiments (n ≥ 3 experiments). c Peak mitochondrial Ca2+ levels following TCR/CD28 stimulation; mean ± SEM; *p < 0.05 vs. control, one-way ANOVA

Journal: Purinergic Signalling

Article Title: Autocrine stimulation of P2Y1 receptors is part of the purinergic signaling mechanism that regulates T cell activation

doi: 10.1007/s11302-019-09653-6

Figure Lengend Snippet: P2Y1 and P2X4 receptors activate mitochondria in response to TCR/CD28 stimulation. a Jurkat cells expressing the mitochondrial Ca2+ indicator mito-CAR-GECO1 were pretreated for 10 min with specific antagonists of P2X4 (5-BDBD, 10 μM) or P2Y1 (MRS2279, 10 μM) receptors or with the general P2 receptor antagonist suramin (100 μM). Then, cells were stimulated by TCR/CD28 cross-linking, and changes in mitochondrial Ca2+ uptake were recorded over time using fluorescence microscopy. Traces of individual cells are shown in gray, and the averages of all cells acquired (n = 30–80) are shown in red. Data shown are representative of independent experiments (n ≥ 3). b Averaged mean fluorescence values (+ SEM) of cells (n = 30-80) from different experiments (n ≥ 3 experiments). c Peak mitochondrial Ca2+ levels following TCR/CD28 stimulation; mean ± SEM; *p < 0.05 vs. control, one-way ANOVA

Article Snippet: Rabbit P2Y1 (Cat. # APR-021) and P2Y12 (Cat. # APR-020) antibodies recognizing extracellular epitopes of human P2Y1 and P2Y12 receptors, respectively, were purchased from Alomone Labs (Jerusalem, Israel).

Techniques: Expressing, Fluorescence, Microscopy

CD4 T cells express ATP-selective P2X and ADP-selective P2Y receptors. a P2 receptor mRNA levels in purified CD4 T cells were determined with qPCR using CD4 T cells isolated from healthy human subjects or Jurkat T cells (mean ± SD, n = 3; n.d., not detected). b Total protein expression of P2Y1 and P2Y12 receptors in human CD4 T cells before and after TCR/CD28 stimulation. The results shown are representative of n = 3 experiments with cells from different subjects. c–d Cell surface expression of P2Y1 and P2Y12 receptors on human CD4 T cells was assessed with flow cytometry before or 72 h after TCR/CD28 stimulation. Representative histograms (c) and summarized data (d) of unstimulated (n = 5) or stimulated (n = 4) cell preparations with cells from different donors are shown (*p < 0.05, Mann-Whitney test). e Polarized P2Y1 receptor expression and translocation to the immune synapse during T cell stimulation. The cell surface expression of P2Y1 and P2Y12 receptors on Jurkat T cells was analyzed with immunofluorescence imaging before and after stimulation of cells with anti-CD3/CD28 antibody-coated beads (indicated with asterisks) to mimic the formation of an immune synapse. Images are representative of separate experiments (n = 3) comprising at least 50 cells. Scale bar 10 μm; ×100 oil objective

Journal: Purinergic Signalling

Article Title: Autocrine stimulation of P2Y1 receptors is part of the purinergic signaling mechanism that regulates T cell activation

doi: 10.1007/s11302-019-09653-6

Figure Lengend Snippet: CD4 T cells express ATP-selective P2X and ADP-selective P2Y receptors. a P2 receptor mRNA levels in purified CD4 T cells were determined with qPCR using CD4 T cells isolated from healthy human subjects or Jurkat T cells (mean ± SD, n = 3; n.d., not detected). b Total protein expression of P2Y1 and P2Y12 receptors in human CD4 T cells before and after TCR/CD28 stimulation. The results shown are representative of n = 3 experiments with cells from different subjects. c–d Cell surface expression of P2Y1 and P2Y12 receptors on human CD4 T cells was assessed with flow cytometry before or 72 h after TCR/CD28 stimulation. Representative histograms (c) and summarized data (d) of unstimulated (n = 5) or stimulated (n = 4) cell preparations with cells from different donors are shown (*p < 0.05, Mann-Whitney test). e Polarized P2Y1 receptor expression and translocation to the immune synapse during T cell stimulation. The cell surface expression of P2Y1 and P2Y12 receptors on Jurkat T cells was analyzed with immunofluorescence imaging before and after stimulation of cells with anti-CD3/CD28 antibody-coated beads (indicated with asterisks) to mimic the formation of an immune synapse. Images are representative of separate experiments (n = 3) comprising at least 50 cells. Scale bar 10 μm; ×100 oil objective

Article Snippet: Rabbit P2Y1 (Cat. # APR-021) and P2Y12 (Cat. # APR-020) antibodies recognizing extracellular epitopes of human P2Y1 and P2Y12 receptors, respectively, were purchased from Alomone Labs (Jerusalem, Israel).

Techniques: Purification, Isolation, Expressing, Flow Cytometry, MANN-WHITNEY, Translocation Assay, Cell Stimulation, Immunofluorescence, Imaging

P2Y1 and P2X4 receptors regulate cytosolic Ca2+ signaling in response to TCR/CD28 stimulation. a Primary human CD4 T cells were loaded with the cytosolic Ca2+ probe Fluo-4 AM, pretreated for 10 min with specific antagonists of P2X4 (5-BDBD, 10 μM) or P2Y1 (MRS2279, 10 μM) receptors or with the general P2 receptor antagonist suramin (100 μM). Then, cells were stimulated by TCR/CD28 cross-linking, and changes in cytosolic Ca2+ levels were recorded over time using live-cell fluorescence microscopy. Traces of individual cells are shown in gray, and averages of all cells studied (n = 120–350) are shown in red. Data shown are representative of different experiments (n ≥ 3) with cells from different donors. b Averaged mean fluorescence values (+ SEM) of cells from at least three different donors (n = 120-350 per experiment). c Peak Ca2+ levels following TCR/CD28 stimulation; mean ± SEM; *p < 0.05 vs. control, one-way ANOVA

Journal: Purinergic Signalling

Article Title: Autocrine stimulation of P2Y1 receptors is part of the purinergic signaling mechanism that regulates T cell activation

doi: 10.1007/s11302-019-09653-6

Figure Lengend Snippet: P2Y1 and P2X4 receptors regulate cytosolic Ca2+ signaling in response to TCR/CD28 stimulation. a Primary human CD4 T cells were loaded with the cytosolic Ca2+ probe Fluo-4 AM, pretreated for 10 min with specific antagonists of P2X4 (5-BDBD, 10 μM) or P2Y1 (MRS2279, 10 μM) receptors or with the general P2 receptor antagonist suramin (100 μM). Then, cells were stimulated by TCR/CD28 cross-linking, and changes in cytosolic Ca2+ levels were recorded over time using live-cell fluorescence microscopy. Traces of individual cells are shown in gray, and averages of all cells studied (n = 120–350) are shown in red. Data shown are representative of different experiments (n ≥ 3) with cells from different donors. b Averaged mean fluorescence values (+ SEM) of cells from at least three different donors (n = 120-350 per experiment). c Peak Ca2+ levels following TCR/CD28 stimulation; mean ± SEM; *p < 0.05 vs. control, one-way ANOVA

Article Snippet: Rabbit P2Y1 (Cat. # APR-021) and P2Y12 (Cat. # APR-020) antibodies recognizing extracellular epitopes of human P2Y1 and P2Y12 receptors, respectively, were purchased from Alomone Labs (Jerusalem, Israel).

Techniques: Fluorescence, Microscopy

P2Y1 receptors promote IL-2 expression in response to TCR/CD28 stimulation. a CD4 T cells were treated for 10 min with the indicated concentrations of the P2Y1 antagonist MRS2279 and stimulated for 5 min with anti-CD3/CD28 antibody-coated microbeads, and ERK1/2 MAPK activation was determined by immunoblotting with phosphospecific anti-ERK1/2 antibodies. Antibodies recognizing total ERK1/2 were used to verify equal protein loading. Data represent mean values ± SD of separate experiments (n = 3); *p < 0.05, one-way ANOVA. b Jurkat cells were stimulated for 4 h with anti-CD3/CD28 antibody-coated beads in the presence of the indicated concentrations of ADP, the P2Y1 antagonist MRS2279, or the general P2 receptor inhibitor suramin (500 μM). IL-2 mRNA levels were determined with qPCR. Data represent mean values ± SD of independent experiments (n = 3–8); §p < 0.05, t test; *,#p < 0.05, one-way ANOVA, compared with untreated controls. c Jurkat cells or primary human CD4 T cells were treated with the non-hydrolysable ADP analogs ADPβS (10 μM; Jurkat cells) or Me-S-ADP (100 nM; T cells) or with the P2Y1 receptor antagonist MRS2279 (60 μM). Then, cells were stimulated with anti-CD3/CD28 antibody-coated beads, and IL-2 mRNA transcription was determined after 4 h. Data are shown as mean ± SD of independent experiments with cells from different donors (n = 3); *, #p < 0.05, one-way ANOVA. d Jurkat cells were transfected with siRNA to silence P2Y1 receptor expression (n = 6) or with an expression plasmid to overexpress P2Y1 receptors (n = 9). Then, cells were stimulated with anti-CD3/CD28 antibody-coated beads, and IL-2 mRNA transcription was measured after 4 h (mean ± SD; *p < 0.05, one-way ANOVA)

Journal: Purinergic Signalling

Article Title: Autocrine stimulation of P2Y1 receptors is part of the purinergic signaling mechanism that regulates T cell activation

doi: 10.1007/s11302-019-09653-6

Figure Lengend Snippet: P2Y1 receptors promote IL-2 expression in response to TCR/CD28 stimulation. a CD4 T cells were treated for 10 min with the indicated concentrations of the P2Y1 antagonist MRS2279 and stimulated for 5 min with anti-CD3/CD28 antibody-coated microbeads, and ERK1/2 MAPK activation was determined by immunoblotting with phosphospecific anti-ERK1/2 antibodies. Antibodies recognizing total ERK1/2 were used to verify equal protein loading. Data represent mean values ± SD of separate experiments (n = 3); *p < 0.05, one-way ANOVA. b Jurkat cells were stimulated for 4 h with anti-CD3/CD28 antibody-coated beads in the presence of the indicated concentrations of ADP, the P2Y1 antagonist MRS2279, or the general P2 receptor inhibitor suramin (500 μM). IL-2 mRNA levels were determined with qPCR. Data represent mean values ± SD of independent experiments (n = 3–8); §p < 0.05, t test; *,#p < 0.05, one-way ANOVA, compared with untreated controls. c Jurkat cells or primary human CD4 T cells were treated with the non-hydrolysable ADP analogs ADPβS (10 μM; Jurkat cells) or Me-S-ADP (100 nM; T cells) or with the P2Y1 receptor antagonist MRS2279 (60 μM). Then, cells were stimulated with anti-CD3/CD28 antibody-coated beads, and IL-2 mRNA transcription was determined after 4 h. Data are shown as mean ± SD of independent experiments with cells from different donors (n = 3); *, #p < 0.05, one-way ANOVA. d Jurkat cells were transfected with siRNA to silence P2Y1 receptor expression (n = 6) or with an expression plasmid to overexpress P2Y1 receptors (n = 9). Then, cells were stimulated with anti-CD3/CD28 antibody-coated beads, and IL-2 mRNA transcription was measured after 4 h (mean ± SD; *p < 0.05, one-way ANOVA)

Article Snippet: Rabbit P2Y1 (Cat. # APR-021) and P2Y12 (Cat. # APR-020) antibodies recognizing extracellular epitopes of human P2Y1 and P2Y12 receptors, respectively, were purchased from Alomone Labs (Jerusalem, Israel).

Techniques: Expressing, Activation Assay, Western Blot, Transfection, Plasmid Preparation

Proposed mechanisms by which P2X4 and P2Y1 receptors synergize to regulate T cells. Stimulation of their T cells via T cell receptor (TCR) and CD28 coreceptors triggers mitochondrial ATP production and ATP release through pannexin-1 channels (Panx1). The released ATP activates P2X4 receptors that promote Ca2+ influx. Hydrolysis of extracellular ATP by ectonucleotide triphosphate diphosphohydrolases (ENTPD) generates ADP that activates P2Y1 receptors that contribute to the increase in intracellular Ca2+ concentrations. Increased mitochondrial activity, P2X4 and P2Y1 receptor Ca2+ signaling increases ATP release and fuel an autocrine feed-forward signaling mechanism that enhances T cell activation, and subsequent downstream signaling pathways that culminate in IL-2 transcription and effector functions involved in inflammation and host defense

Journal: Purinergic Signalling

Article Title: Autocrine stimulation of P2Y1 receptors is part of the purinergic signaling mechanism that regulates T cell activation

doi: 10.1007/s11302-019-09653-6

Figure Lengend Snippet: Proposed mechanisms by which P2X4 and P2Y1 receptors synergize to regulate T cells. Stimulation of their T cells via T cell receptor (TCR) and CD28 coreceptors triggers mitochondrial ATP production and ATP release through pannexin-1 channels (Panx1). The released ATP activates P2X4 receptors that promote Ca2+ influx. Hydrolysis of extracellular ATP by ectonucleotide triphosphate diphosphohydrolases (ENTPD) generates ADP that activates P2Y1 receptors that contribute to the increase in intracellular Ca2+ concentrations. Increased mitochondrial activity, P2X4 and P2Y1 receptor Ca2+ signaling increases ATP release and fuel an autocrine feed-forward signaling mechanism that enhances T cell activation, and subsequent downstream signaling pathways that culminate in IL-2 transcription and effector functions involved in inflammation and host defense

Article Snippet: Rabbit P2Y1 (Cat. # APR-021) and P2Y12 (Cat. # APR-020) antibodies recognizing extracellular epitopes of human P2Y1 and P2Y12 receptors, respectively, were purchased from Alomone Labs (Jerusalem, Israel).

Techniques: Activity Assay, Activation Assay